Advanced
Identification and Functional Analysis of Pig β-1,4-N-Acetylglucosaminyltransferase A (MGAT4A)
Identification and Functional Analysis of Pig β-1,4-N-Acetylglucosaminyltransferase A (MGAT4A)
Journal of Life Science. 2016. Mar, 26(3): 275-281
Copyright © 2016, Korean Society of Life Science
This is an Open-Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/3.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.
  • Received : August 25, 2015
  • Accepted : October 29, 2015
  • Published : March 30, 2016
Download
PDF
e-PUB
PubReader
PPT
Export by style
Article
Author
Metrics
Cited by
TagCloud
About the Authors
지윤, 김
환진, 황
학재, 정
미령, 박
승준, 변
경운, 김
kw72kim@korea.kr

Abstract
인체치료용 당단백질은 바이오의약품에 있어서 중요한 요소이며 특히, 단백질 말단에 결합되어있는 시알산은 의약품의 체내 활성이나 안정성에 큰 영향을 미친다. 최근 돼지유즙은 바이오의약품을 생산하기 위한 생체반응기로써 주목받고 있다. β -1,4-N-acetylglucosaminyltransferase A (MGAT4A)는 재조합단백질이 가지는 시알산 함량을 늘리기 위한 필수 효소 중 하나이다. 그러나 돼지 MGAT4A는 아직도 그 서열이나 기능이 불분명하다. 따라서 이번 연구에서는 돼지 MGAT4A의 서열 동정 및 기능분석을 하였다. 돼지 MGAT4A는 535개의 아미노산을 코딩하는 1,638개의 염기서열로 이루어져 있으며, 일반적인 당전이효소들의 특징인 type II membrane topology의 특성을 가지고 있다. Real-time PCR분석법을 통하여, 지금까지 알려진 것과는 조금 다르게 MGAT4A 유전자가 간이나 유선에서 많은 발현을 보였으나 소장이나 위, 방광에서는 그 발현량이 적다는 것도 확인하였다. 또한, 효소의 기능 분석을 위하여 PK-15 세포주에서 MGAT4A효소의 과발현을 유도하였다. 과발현이 확인된 세포주로 렉틴을 이용한 면역형광염색법과 ELISA방법으로 MGAT4A효소의 과발현이 β -1,4-N-acetylglucosamine의 함량을 증가시켰음을 확인하였다. 또한 기질반응을 통해 bi-antennary structure에 대한 반응성도 확인하였으며, MGAT4A의 과발현이 유도된 세포에서 약 3배 이상의 높은 기질 반응성을 보였다. 이러한 연구는 생체반응기로써 돼지를 이용하는데 있어서 중요한 기반이 될 것이라고 생각한다.
Keywords
서 론
시판되는 인체 치료용 단백질들은 대부분 미생물이나 동물 세포를 이용하여 생산하고 있으나, 최근 형질전환 동물을 이용한 생체반응기(Bioreactor)개발에 힘입어 유산양, 염소, 토끼, 돼지 등과 같은 포유동물 유즙이 주목을 받고 있다 [3 , 8 , 10 , 17] . 특히, 돼지는 생리적으로 인간과 비슷하다는 것만 아니라 임신기간이 인간과 비교해 짧고 후대를 많이 생산할 수 있다는 장점을 가지고 있기 때문에 다른 포유동물들보다 치료용 단백질생산에 유리하다고 생각되어 erythropoietin (EPO), Factor IX, von Willebrand Factor (vWF) 등과 같은 인체 치료물질을 생산하는 형질전환돼지(transgenic pig)가 개발되었다 [7 , 9 , 12 - 14 , 16] .
EPO는 결합되어 있는 당사슬에 의하여 체내활성이나 반감기가 조절되는 가장 대표적인 당단백질 의약품이며 당사슬의 말단에 결합되어 있는 시알산(sialic acid)이 가장 중요한 요소로 알려져 있다 [18 , 19] . 말단에 있는 시알산의 함량이 높아지면 EPO는 체내 안정성이 높아져 더 긴 반감기를 가질 수 있는 반면에 당화가 일어나지 않는 대장균에서 발현된 EPO는 체내에서 활성을 거의 갖지 못한다 [1 , 2] .
형질전환돼지 유즙으로부터 생산된 Factor IX의 당 사슬의 구조를 분석해보니 대부분의 당사슬은 bi-antennary 구조였고, tri-, tetra-anttenarry 구조의 함량은 매우 적었다 [6] . 수유기 동안에 유선에서 발현되는 당 전이효소에 의해 생성된 구조이기 때문에 돼지로부터 생산되는 EPO의 경우도 대부분 bi-antennary 구조를 가질 것이라고 판단된다 [10 , 15] .
따라서 치료용 당단백질을 생산하려면 형질전환돼지의 유선에서도 몇 가지 당 전이효소의 추가적인 조절이 필요할 것으로 생각되며, 그 중 하나가 N-형 당사슬에 antennary-분지를 만들어주는 β -1,4-N-acetylglucosaminyltransferase A (MGAT4A)이다. 유선에서 이 효소의 추가적인 발현은 EPO와 같은 치료용 당단백질이 더 많은 시알산을 함유할 것으로 생각된다. 하지만 돼지에서는 MGAT4A의 서열이나 기능이 명확히 알려져 있지 않기 때문에 본 연구에서 돼지로부터 MGAT4A를 동정하고 그 기능을 분석하고자 하였다.
재료 및 방법
- RNA분리와 cDNA합성
국립축산과학원에서 사육되고 있는 랜드레이스(Landrace) 돼지로부터 얻은 각 장기조직들은 Trizol (Invitrogen, USA)과 homogenizer로 분쇄하고 total RNA를 분리하였다. 분리된 total RNA 1 μg을 First-Strand cDNA Synthesis Kit (GE healthcare, USA)를 사용하여 cDNA를 합성하였다(동물실험 승인번호: NIAS2015-593).
- 돼지 MGAT4A 유전자 클로닝
돼지 MGAT4A의 서열을 동정하기 위하여, 다른 종들에서 알려진 MGAT4A의 서열을 비교하여 degenerated primer를 제작하였다. 제작된 forward primer는 5’- TGGTAYACNAC NTGGCARAAY-3’이고, reverse primer는 5’- YTCNARDAT NGCCCANACNGC -3’이다. 주형으로 돼지 liver에서 분리한 total RNA로 합성한 cDNA를 사용하여 PCR을 수행하였다. 조건은 94℃에서 3분간 pre-incubation하였으며, 94℃에서 30초, 42℃에서 30초, 72℃에서 1분 30초의 조건으로 30 cycles을 반응하였고, 72℃에서 5분간 반응을 추가로 진행하였다.
5’-과 3’-RACE는 GeneRacer Kit (Invitrogen, USA)를 사용하여 제시된 실험방법대로 실험을 수행하였으며 주형으로 사용한 total RNA는 돼지 liver에서 분리한 total RNA를 사용하여 수행하였다. 5’-RACE에는 5’-anchor primer: 5’-CTCTTTCTC GAGGTTGGCT ACAACACC-3’와 GeneRacer 5’primer, 3’-RACE에는 3’-anchor primer: 5’-TGAAGGTCTACCAAGG ACATACACTGG-3’와 GeneRacer 3’primer를 각각 사용하여 수행하였다. 증폭된 RACE PCR산물은 agarose gel (Takara, Japan)에 전기영동 후, gel extraction kit (Qiagen, Germany)로 정제하여 TOPO-TA cloning kit (Invitrogen, USA)을 사용하여 cloning하였다. 선별된 DNA클론들은 sequencing을 실시하여 염기서열을 분석하였고 다른 종에서 알려진 MGAT4A 유전자 및 단백질과 비교하여 돼지 MGAT4A유전자를 동정하였다.
- Quantitative Real-time RT-PCR (qPCR)
돼지 장기조직간 MGAT4A을 발현을 in vitro 에서 비교하기 위하여 qPCR을 수행하였다. LightCycler FastStart DNA Master SYBR Green I (Roche Diagnostics, USA)를 사용하여 95℃에서 4분간 pre-incubation하였으며, 95℃에서 10초, 58℃에서 5초, 72℃에서 4초의 조건으로 45cycles를 진행하였다. 돼지 MGAT4A를 위한 forward primer는 5’-CCACGTGGCA AAATGGGAAAG-3’이고, reverse primer는 5’-TACGCGTTT GAACTGCTGCAC-3’이다. 대조구로 사용된 β -actin을 위한 forward primer는 5’- CATCACCATCGGCAACGAGC -3’이고, reverse primer는 5’- TAGAGGTCCTTG CGGATGTC -3’이다.
- 세포배양조건 및 MGAT4A의 과발현
돼지 MGAT4A의 기능분석을 위하여 돼지신장세포인 PK-15 세포주를 사용하였다. 세포는 10% FBS (heat inactivated fetal bovine serum)와 50 units/ml의 penicillin, 50 μg/ml streptomycin을 포함하는 DMEM (Dulbecco’s modified Eagle’s medium) high glucose (Invitrogen, USA)에서 37˚C, 5% CO 2 의 조건으로 배양하였다. 돼지 HA-tagged MGAT4A를 pcDNA3.1 vector의 EcoR V와 Not I 부위에 삽입 후 Pvu I을 이용하여 절단하였다. 절단된 vector는 lipofectamine (Invitrogen, USA)을 이용하여 세포에 transfection하였고, 2주간 800 μg/ml의 G418 (Invitrogen, USA)을 사용하여 selection하였다. 이 후, 돼지 MGAT4A가 과발현 된 세포를 PK-p4A로, pcDNA3.1-mock stable cell line을 PK-Con으로 명명하였다.
- 면역형광염색
세포를 Lab-Tek chamber slide (BD, USA)에서 24시간 동안 배양시킨 후 PBS (phosphate-buffer saline)로 세척하였다. 세포를 고정하기 위하여 3.7% formaldehyde에서 10분간 반응 후, 고정된 세포는 막투과를 위해 −20℃에서 methanol에 15분간 반응시켰다. PBS로 세척 후, blocking buffer (PBS with 1% BSA and 0.2% Triton-X 100)에서 1시간 동안 정치하였다. 이후 10μg/ml의 biotin-conjugated DSA와 Streptavidine-conjugated Texas-red (1:2,000 dilution)를 사용하여 형광표지를 하였다. 시약은 dilution buffer (PBS with 1% BSA and 0.05% Triton-X 100)를 사용하여 희석하였다. 핵은 1μg/ml의 DAPI를 이용하여 염색하였고 형광현미경을 이용하여 관찰하였다.
골지체는 BODIPY ® TR ceramide (Invitrogen, USA)로, HA-tagged MGAT4A는 HA항체(SantaCruz, USA)를 이용하여 확인하였다.
- Enzyme-linked immunosorbent assay (ELISA)
각 세포는 Opti-MEM배지에서 배양되었으며, 3일 후 배양액을 회수하여 사용하였다. EIA/RIA plate에 0.05 M carbonate bicarbonate buffer를 이용하여 well당 10 μg의 단백질을 coating하였다(상온에서 1시간 정치). 0.05% TBST (Tris-buffer saline with 0.05% tween20)로 세척 후, well당 200 μl의 blocking buffer (0.05% TBST with 1% BSA)를 첨가한 후 30분간 상온에서 정치하였다. Blocking 후, well당 100 μl의 2 μg/ml의 biotin-conjugated DSA를 첨가하여 1시간 동안 상온에서 정치하였다. 세척 후, 1:5,000으로 희석된 streptavidin-conjugated HRP를 well당 100 μl씩 첨가하고 상온에서 30분간 정치하였다. 0.05% TBST를 이용하여 plate를 세척한 후 상온에서 5분간 건조하였다. 건조된 plate의 각 well에 100 μl의 TMB substrate를 첨가 후, 상온에서 20분 간 반응시켰다. 반응을 중지시키기 위해서 100 μl의 2M HCl을 첨가하였다. 5분간 정치 후, 450 nm에서 흡광도를 측정하였다.
- 기질반응을 통한 돼지 MGAT4A의 활성 측정
클로닝된 돼지 MGAT4A의 기질반응성을 확인하기 위하여 Glycosyltransferase Activity Kit (R&D Systems, USA)를 사용하여 1 mM N-glycan core structure (bi-antennary)에 대한 200 μM UDP-GlcNAc (Sigma-Aldrich, USA) 활성반응을 측정하였다 [21] . 실험에 사용된 효소는 과발현된 세포로부터 MPER buffer (Thermo, USA)를 이용, 추출하여 37℃에서 5시간 동안 반응하였다. 반응 후, 655 nm에서 흡광도를 측정하여 효소활성을 분석하였다.
- 통계처리
실험에서 얻어진 결과는 SAS 9.2를 이용하여 최소 유의차 검정과 General Linear Models 절차를 이용한 Duncan’s multiple range test을 적용하였으며, p <0.05 수준에서 유의차를 검정하였다.
결과 및 고찰
- PCR방법을 통한 돼지 MGAT4A의 동정
사람이나 소와 같은 동물의 MGAT4A의 유전자 서열은 이미 알려져 있기 때문에 GeneBank database에 등록되어 있는 염기서열정보들을 찾아 유전자들에 대한 상동성을 비교하여 돼지 MGAT4A유전자 동정을 위한 degeneration primer를 제작하였다. 제작된 primer를 사용하여 degeneration PCR 방법으로 MGAT4A유전자 클로닝을 시도하였고 증폭된 PCR산물은 TA-클로닝을 실시하여 얻어진 클론들에 대한 염기서열을 확인하였다. PCR에 의해 얻어진 유전자 파편은 ORF기준 67번 염기부터 1572번 염기까지였고 다른 부위는 RACE 클로닝을 통해 5’-과 3’-UTR부위는 밝혀냈다( Fig. 1A ). 클로닝된 1863개 염기서열 중 돼지 MGAT4A의 open reading frame (ORF)은 535개의 아미노산을 구성하는 1638개의 nucleotide로 구성되어 있으며( Fig. 1B ), 다른 종들과도 높은 상동성을 보였다. 아미노산 서열은 다른 종들과 90%가 넘는 상동성을 보였으며, 특히 사람과 쥐(rat)와의 상동성은 96%로 가장 높았다. 또한 계통분석을 통해 소와 유전적 연관성이 가장 가깝다는 것을 확인하였다( Fig. 2A ).
PPT Slide
Lager Image
Putative pig MGAT4A cDNA (A) Schematic representation of pig MGAT4A cDNA clones. An open bar represent the protein coding region and thick lines indicate the noncoding regions of the MGAT4A. D, Degeneration PCR clone, R, RACE clone Thin and small arrow represent the position and direction of primers. (B) Nucleotide and deduced amino acid sequences of pig MGAT4A. The putative transmembrane domain is underlined. open circles asparagine residues indicate potential N-glycosylation sites. The nucleotide sequences reported in this paper has been submitted to the GenBankTM/EMBL Data Bank with accession number JN975035.
PPT Slide
Lager Image
Pig MGAT4A was analyzed with MGAT4A of other species. (A) Homology of DNA and amino acid. (B) Hydropathy was calculated according to Kyte and Doolittle [11].
- 다양한 조직에서 MGAT4A의 발현량 비교
조직들에서 MGAT4A 유전자의 발현 양상을 확인하기 위하여 우리는 qPCR을 통해 분석하였다. 성돈(adult pig)에서는 다른 조직들과 비교해서 간과 유선에서 그 발현 정도가 높았으며, 위나 소장, 방광에서는 발현이 매우 미약했다( Fig. 3A ). 자돈(piglet)에서도 간에서의 발현량이 높았다( Fig. 3B ). 하지만 사람의 경우, MGAT4A 발현은 간에서 매우 낮게 나타나는 것으로 보고되어 있어 MGAT4A의 조직간 발현 양상은 사람과 돼지에서 차이를 보였다 [21] .
PPT Slide
Lager Image
Transcript level of MGAT4A from (A) adult tissues and (B) piglet tissues was analyzed by qPCR. H: Heart, Lu: Lung, Lv:Liver, Sp: Spleen, K: Kidney, St: Stomach, S.ins: Small intestine, L.ins: Large intestine, Bl: Bladder, M: muscle, MG: mammary gland; The error bar means ± SD.
- MGAT4A의 기능 분석
돼지 MGAT4A의 기능분석을 위하여, 돼지 신장세포인 PK-15세포에 MGAT4A유전자를 과발현시켜 확인하였다. 분리된 세포들을 RT-PCR로 분석하여 MGAT4A 과발현 세포인 PK-p4A에서 MGAT4A의 발현이 PK-Con보다 높다는 것을 확인하였고( Fig. 4A ), 면역형광염색을 통해 단백질로의 번역 또한 확인하였다. 이 때, 대부분의 당 전이효소가 골지체에서 그 역할을 수행하기 때문에 골지체를 함께 염색하여 분석한 결과 MGAT4A효소도 골지에 위치한다는 것을 확인할 수 있었다 ( Fig. 4B ) [19] .
PPT Slide
Lager Image
Expression and functional test of pig MGAT4A gene in PK-15 cell line; (A) RT-PCR was performed using cDNA of PK-Con and PK-p4A. (B) Co-immunostaining using MGAT4A (green) and Golgi complex (red) show that MGAT4A is localized within Golgi complex. Nucleus was stained with DAPI (blue). (C) Function of pig MGAT4A was analyzed by immunostaining using DSA lectin (red). Nucleus was stained with DAPI (blue). (D) Measuring pig MGAT4A enzyme activity using the DSA lectin ELISA. (E) The activity of overexpressed pig MGAT4A was measured using the donor substrate UDP-GlcNAc (acceptor N-glycan core structure). *: Mean±SD
우리가 클로닝한 MGAT4A는 α 1,3-mannose에 N-acetyl-glucosamine의 β 1,4 결합을 촉매하여 당사슬분지를 늘리는 효소로 렉틴(lectin)의 일종인 DSA가 MGAT4A의 산물인 당사슬 구조를 인지할 수 있어 당전이효소기능을 확인하기 위해 사용된다. 따라서 본 연구에서는 DSA를 이용하여 면역염색을 실시하였으며, PK-p4A에서 PK-Con보다 더 강하게 DSA가 염색이 되는 결과를 얻었다( Fig. 4C ). 이는 MGAT4A의 발현이 PK-15 세포에서 β 1,4-N-acetylglucosamine 구조 증가에 영향을 주었음을 보여주는 결과이며 또한, 배양배지를 이용한 ELISA 결과도 PK-p4A에서 약 1.3배 β 1,4-N-acetylglucosamine 구조가 증가했음을 보여 주었다( Fig. 4D ). 이러한 결과는 MGAT4A가 세포내 단백질, 분비단백질의 구분 없이 당사슬을 부과한다는 것을 알 수 있었다. 또한 DSA는 β 1,4-N-acetylglucosamine 구조 이외에도 polylactosamine 구조도 인지할 수 있어 대조군으로 polylactosamine 구조를 특이적으로 인지할 수 있는 LEA를 사용하여 면역형광염색과 ELISA를 동시에 실시하였다. 실험 결과, LEA에 의한 인지는 두 세포에서 거의 검출되지 않았다.
또한 당사슬 기질반응을 통해 MGAT4A의 활성을 평가하였다 [20] . 사용된 기질인 bi-antennery 구조에 효과적으로 β 1, 4-N-acetylglucosamine이 부과되는지 확인하기 위하여 실험을 진행하였다. 실험 결과, PK-Con의 반응성은 35.5±15.43 pmol/min/mg, PK-p4A의 반응성은 133.77±11.09 pmol/min/mg으로 측정되어 PK-p4A이 PK-Con보다 기질에 대한 반응성이 3배 이상 높았다( Fig. 4E ).
이러한 활성은 치료용 단백질은 생산하는 돼지에서도 요구된다. MGAT4A에 의한 β 1,4-N-acetylglucosamine구조의 증가는 단백질의 체내 반감기나 활성에 영향을 주는 시알산의 함량과 연관이 있기 때문이다 [19] . N-형 당사슬 분지의 증가는 시알산 증가도 함께 일어날 수 있기 때문에 치료용 단백질의 체내 안정성의 증가를 기대할 수 있다. 따라서 돼지 MGAT4A 유전자의 동정은 돼지를 이용한 치료용 단백질의 생산에 있어서 중요하다고 생각한다.
이번에 클로닝한 MGAT4A는 2-4 branched triantennary N-glycan을 구성하는 효소이므로 단백질 말단에 최대한으로 당사슬을 늘리기 위해서는 추가적으로 유선내 MGAT5도 발현이 필요할 것으로 생각된다. MGAT5는 α 1,6-mannose에 N-acetylglucosamine의 β 1,6 연결을 촉매하는 효소로 N-형 당사슬의 tetraantennary를 만드는 효소이다 [4] . 하지만 두 효소의 발현만으로는 당사슬 말단에 존재하는 시알산의 함량을 늘리는데는 한계가 있을 것으로 생각된다. 효과적으로 말단의 시알산 함량을 늘리기 위해서는 시알산 전이효소의 발현도 필요할 것으로 생각된다 [5] . 따라서 유선내에서 시알산 전이효소와 MGAT4A, MGAT5의 추가적인 발현은 치료용 단백질을 생산하는데 있어서 중요하다고 생각한다. 하지만 아직까지도 돼지에서는 많은 당 전이효소들이 명확히 알려져 있지 않다. 유선세포에서 발현되는 당 전이효소의 기능 분석은 돼지를 생체반응기로써 이용하는데 있어서 중요한 기반이 될 것이라고 생각한다.
Acknowledgements
본 논문은 농촌진흥청 연구사업(형질전환동물 유래 혈관질환 치료제 재조합 단백질 분리정제 및 이화학 분석, 과제번호: PJ01097601)의 지원에 의해 이루어진 것입니다.
References
Egrie J. C. , Dwyer E. , Browne J. K. , Hitz A. , Lykos M. A. 2003 Darbepoetin alfa has a longer circulating half-life and greater in vivo potency than recombinant human erythropoietin Exp. Hematol. 31 290 - 299    DOI : 10.1016/S0301-472X(03)00006-7
Elliott S. , Egrie J. , Browne J. , Lorenzini T. , Busse L. , Rogers N. , Ponting I. 2004 Control of rHuEPO biological activity: the role of carbohydrate Exp. Hematol. 32 1146 - 1155    DOI : 10.1016/j.exphem.2004.08.004
Freitas V. J. , Serova I. A. , Andreeva L. E. , Dvoryanchikov G. A. , Lopes E. S. , Teixeira D. I. , Dias L. P. , Avelar S. R. , Moura R. R. , Melo L. M. , Pereira A. F. , Cajazeiras J. B. , Andrade M. L. , Almeida K. C. , Sousa F. C. , Carvalho A. C. , Serov O. L. 2007 2007. Production of transgenic goat (Capra hircus) with human granulocyte colony stimulating factor (hG-CSF) gene in Brazil An. Acad. Bras. Cienc. 79 585 - 592    DOI : 10.1590/S0001-37652007000400003
Fukuta K. , Abe R. , Yokomatsu T. , Kono N. , Asanagi M. , Omae F. , Minowa M. T. , Takeuchi M. , Makino T. 2000 Remodeling of sugar chain structures of human interferon-gamma Glycobiology 10 421 - 430    DOI : 10.1093/glycob/10.4.421
Fukuta K. , Yokomatsu T. , Abe R. , Asanagi M. , Makino T. 2000 Genetic engineering of CHO cells producing human interferon-gamma by transfection of sialyltransferases Glycoconj. J. 17 895 - 904    DOI : 10.1023/A:1010977431061
Gil G. C. , Velander W. H. , Van Cott K. E. 2008 Analysis of the N-glycans of recombinant human Factor IX purified from transgenic pig milk Glycobiology 18 526 - 539    DOI : 10.1093/glycob/cwn035
Houdebine L. M. 2009 Production of pharmaceutical proteins by transgenic animals Comp. Immunol. Microbiol. Infect. Dis. 32 107 - 121    DOI : 10.1016/j.cimid.2007.11.005
Jänne J. , Hyttinen J. M. , Peura T. , Tolvanen M. , Alhonen L. , Sinervirta R. , Halmekytö M. 1994 Transgenic bioreactors Int. J. Biochem. 26 859 - 870    DOI : 10.1016/0020-711X(94)90078-7
Ko H. K. , Song K. H. , Jin U. H. , Seong H. H. , Chang Y. C. , Kim N. H. , Kim D. S. , Lee Y. C. , Kim C. H. 2010 Molecular characterization of pig alpha2,3-Gal-beta1,3- GalNAc-alpha2,6-sialyltransferase (pST6GalNAc IV) gene specific for Neu5Acalpha2-3Galbeta1-3GalNAc trisaccharide structure Glycoconj. J. 27 367 - 374    DOI : 10.1007/s10719-010-9284-3
Koles K. , van Berkel P. H. , Mannesse M. L. , Zoetemelk R. , Vliegenthart J. F. , Kamerling J. P. 2004 Influence of lactation parameters on the N-glycosylation of recombinant human C1 inhibitor isolated from the milk of trans-genic rabbits Glycobiology 14 979 - 986    DOI : 10.1093/glycob/cwh127
Kyte J. , Doolittle R. F. 1982 A simple method for displaying the hydropathic character of a protein J. Mol. Biol. 157 105 - 132    DOI : 10.1016/0022-2836(82)90515-0
Lee H. G. , Lee H. C. , Kim S. W. , Lee P. , Chung H. J. , Lee Y. K. , Han J. H. , Hwang I. S. , Yoo J. I. , Kim Y. K. , Kim H. T. , Lee H. T. , Chang W. K. , Park J. K. 2009 Production of recombinant human von Willebrand factor in the milk of transgenic pigs J. Reprod. Dev. 55 484 - 490    DOI : 10.1262/jrd.20212
Lee P. , Chung H. K. , Lee H. G. , Lee H. C. , Woo J. S. , Lee S. , Jo S. J. , Chang W. K. , Lee H. T. , Kwon M. , Park J. K. 2008 Cloning and characterization of 5'-untranslated region of porcine beta casein gene (CSN2) Domest. Anim. Endocrinol. 35 245 - 253    DOI : 10.1016/j.domaniend.2008.04.001
Lindsay M. , Gil G. C. , Cadiz A. , Velander W. H. , Zhang C. , Van Cott K. E. 2004 Purification of recombinant DNA-derived factor IX produced in transgenic pig milk and fractionation of active and inactive subpopulations J. Chromatogr. A. 1026 149 - 157    DOI : 10.1016/j.chroma.2003.11.006
Montesino R. , Toledo J. R. , Sánchez O. , Sánchez A. , Harvey D. J. , Royle L. , Dwek R. A. , Rudd P. M. , Gerwig G. J. , Kamerling J. P. , Cremata J. A. 2008 Monosialylated biantennary N-glycoforms containing GalNAc-GlcNAc antennae predominate when human EPO is expressed in goat milk Arch. Biochem. Biophys. 470 163 - 175    DOI : 10.1016/j.abb.2007.11.019
Park J. K. , Lee Y. K. , Lee P. , Chung H. J. , Kim S. , Lee H. G. , Seo M. K. , Han J. H. , Park C. G. , Kim H. T. , Kim Y. K. , Min K. S. , Kim J. H. , Lee H. T. , Chang W. K. 2006 Recombinant human erythropoietin produced in milk of transgenic pigs J. Biotechnol. 122 362 - 371    DOI : 10.1016/j.jbiotec.2005.11.021
Schnieke A. E. , Kind A. J. , Ritchie W. A. , Mycock K. , Scott A. R. , Ritchie M. , Wilmut I. , Colman A. , Campbell K. H. 1997 Human factor IX transgenic sheep produced by transfer of nuclei from transfected fetal fibroblasts Science. 278 2130 - 2133    DOI : 10.1126/science.278.5346.2130
Su D. , Zhao H. , Xia H. 2010 Glycosylation-modified erythropoietin with improved half-life and biological activity Int. J. Hematol. 91 238 - 244    DOI : 10.1007/s12185-010-0496-x
Varki A. , Cummings R. D. , Esko J. D. , Freeze H. H. , Stanley P. , Bertozzi C. R. , Hart G. W. , Etzler M. E. 2009 Essentials of Glycobiology 2nd ed. Cold Spring Harbor Laboratory Press NY
Wu Z. L. , Ethen C. M. , Prather B. , Machacek M. , Jiang W. 2011 Universal phosphatase-coupled glycosyltransferase assay Glycobiology 21 727 - 733    DOI : 10.1093/glycob/cwq187
Yoshida A. , Minowa M. T. , Takamatsu S. , Hara T. , Oguri S. , Ikenaga H. , Takeuchi M. 1999 Tissue specific expression and chromosomal mapping of a human UDP-Nacetylglucosamine: alpha1,3-d-mannoside beta1, 4-N-acetylglucosaminyltransferase Glycobiology 9 303 - 310    DOI : 10.1093/glycob/9.3.303