Advanced
Analysis of a Sulfur-oxidizing Perchlorate-degrading Microbial Community
Analysis of a Sulfur-oxidizing Perchlorate-degrading Microbial Community
Journal of Life Science. 2016. Jan, 26(1): 68-74
Copyright © 2016, Korean Society of Life Science
This is an Open-Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/3.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.
  • Received : August 15, 2015
  • Accepted : October 07, 2015
  • Published : January 30, 2016
Download
PDF
e-PUB
PubReader
PPT
Export by style
Article
Author
Metrics
Cited by
TagCloud
About the Authors
영화 김
경림 한
희재 황
혁준 권
예림 김
건우 김
희주 김
명화 손
영익 최
낙창 성
영희 안
yahn@dau.ac.kr

Abstract
퍼클로레이트(ClO 4 )는 지표수 및 토양/지하수에서 검출되는 신규 오염물이다. 이전 연구에서 저렴한 원소 황(elemental sulfur, S 0 ) 입자와 쉽게 구할 수 있는 활성슬러지를 이용하여 독립영양방식으로 ClO 4 를 제거할 수 있다는 실험적 증거가 제시되었다. 또한 식종균으로서 농화배양 미생물을 사용했을 때 활성슬러지보다 제거효율과 시간면에서 우수한 결과를 나타내었다. 그래서 본 연구에서는 황을 산화하여 독립영양방식으로 ClO 4 를 분해하는 농화배양 미생물 군집을 PCR-DGGE로 분석하였다. 이 농화배양 미생물은 초기농도가 약 120 mg ClO 4 /l 일 때 7일 후 99.71% 이상의 ClO 4 - 제거 효율을 나타내었다. 농화배양 미생물과 그것의 식종균으로 부터 genomic DNA를 추출하여 16S rRNA 유전자의 PCR-DGGE 분석에 사용하였다. PCR-DGGE 분석결과 농화배양 미생물과 식종균 시료들이 다른 밴드패턴을 나타냄에 따라 이 두 시료의 군집조성이 다름을 확인하였다. 이는 농화배양되는 동안 식종된 미생물이 그 환경에 잘 생장하는 미생물로 군집조성이 변화한 것으로 여겨진다. 농화배양 미생물군집에는 β-Proteobacteria , Bacteroidetes , 그리고 Spirochaetes 강에 속하는 개체군들이 우점하는 것으로 나타났다. 향후 이 우점 개체군들의 순수분리와 더불어 황 산화를 통한 ClO 4 분해 환경에서 이들의 대사적 역할을 규명할 필요가 있다.
Keywords
서 론
토양/지하수 및 지표수의 신규 오염물인 퍼클로레이트(ClO 4 )는 강한 산화력을 가지고 있으며 군사용 폭발물과 로켓의 추진제에 주로 사용된다. 그 외에도 불꽃놀이용 화약류, 기폭제, 성냥, 윤활유, 에어백 등에 광범위하게 사용되는 화합물이다 [15] . 우리나라에서는 LCD 제조 공정의 세정제로 ClO 4 가 사용됨에 따라 발생한 폐수가 처음 알려졌고, 그 후엔 아연 제련공정에서 배출되는 폐수에 의해서도 ClO 4 오염이 발생한다고 알려졌다 [10 , 11] .
ClO 4 는 비휘발성이고 물에서 화학적으로 안정되어 쉽게 분해되지 않고 용해도가 높다: 20℃에서 NaClO 4 와 NH 3 ClO 4 의 물에 대한 용해도는 각각 2,010 g/l와 209 g/l이다 [15] . 이같은 화학적인 성질로 인해 ClO 4 는 광범위 오염을 초래할 수 있다. 인체에서 ClO 4 는 갑상선에 요오드 흡수를 방해함으로써 체내에서 일어나는 대사와 생장에 필요한 갑상선 호르몬 생산을 저해한다 [15] . 이러한 ClO 4 의 독성으로 인해 우리나라에서는 2008년에 ClO 4 가 수질 오염물질로 신규 지정되었고, 2010년에는 먹는 물 수질 감시항목으로 지정이 됨에 따라 권고 기준 15 μg ClO 4 /l이 설정되었다 [17] . 하지만 아직까지 ClO 4 에 관한 수질오염물질 배출 허용기준은 설정되지 않았다. 발생원으로부터 ClO 4 가 환경에 배출되는 것을 규제하기 위한 배출 허용기준이 설정되지 않은 원인 중의 하나는 처리 기술이 아직 개발되지 않았기 때문이다.
기존의 하수처리장과 정수처리장에서의 ClO 4 처리는 제한적이라는 보고가 있으므로 이런 처리 시설로 유입되기 전에 ClO 4 배출원인 개별업체에서 처리하는 것이 바람직하다. 활성슬러지(activated sludge) 공법만을 이용하는 하수처리장에서는 ClO 4 제거가 거의 되지 않는 것으로 보고되었다 [13] . 또한 정수장의 고도처리시설에서는 활성탄의 사용이 오랜 경우에는 흡착능의 초과로 인해 원수보다 오히려 처리수에 ClO 4 농도가 높게 검출되었다 [11] .
현재 ClO 4 처리법은 물리, 화학적인 방법이 주로 사용되고 [19] 이온교환법(ion exchange)이 대표적이다. 이 방법은 비교적 단순하고 빠르다는 장점이 있으나 한 매질에서 다른 매질로 단순히 ClO 4 를 이동할 뿐 ClO 4 분해는 일어나지 않고 사용한 수지를 주기적으로 재생해야 하는 번거로움과 더불어 폐재생액으로 인한 이차오염을 야기할 수 있다는 단점이 있다. 반면에 미생물을 이용한 생물학적 처리는 ClO 4 를 무해한 산물로 완전히 전환할 수 있으므로 친환경적이며 경제적이다 [3 , 4] . (Per)chlorate-reducing bacteria (PRB)는 적절한 전자공여체가 주어지면 전자수용체인 ClO 4 또는 ClO 3 를 식 1과 같이 순차적으로 환원시키므로 최종적으로 무해한 염소 이온과 산소가 생성된다(식 1):
PPT Slide
Lager Image
원소 황(elemental sulfur, S 0 ) 입자와 활성슬러지를 이용하여 독립영양방식으로 ClO 4 를 제거할 수 있다는 실험적 증거가 이전 연구 [7] 를 통해 제시되었다. 식 2는 원소 황이 물에서 산화되는 반응이고, 식 3은 황을 산화하는 PRB가 ClO 4 를 전자 수용체로 사용하는 반응이다.
PPT Slide
Lager Image
PPT Slide
Lager Image
또한 원소 황을 이용한 ClO 4 제거 공정에서 여러 환경요인들(온도, pH, 초기 biomass 농도, 식종균의 종류 등)이 활성슬러지 미생물의 ClO 4 분해에 미치는 영향을 회분반응으로 조사하여 ClO 4 분해를 위한 최적조건이 도출되었다 [8] . ClO 4 분해 최적조건을 조사하기 위한 실험에서 식종균으로서 농화배양 미생물을 사용했을 때 활성슬러지를 사용한 경우보다 제거효율과 시간 면에서 우수한 결과를 나타내었다. 그러나 아직 그 농화배양 미생물 군집에 대해서는 알려지지 않았다.
대부분의 환경 미생물은 실험실 조건하게 배양이 안되므로 미생물을 배양해서 군집을 분석하는 것은 제한된 정보를 제공하거나 편견을 초래할 수 있다 [16] . PCR-DGGE은 배양에 근거한 군집분석의 단점을 극복할 수 있는 기법 중의 하나로 보고되었다 [1 , 5 , 14 , 16] . 그래서 본 연구에서는 ClO 4 분해를 최적화하기 위해 농화배양 미생물의 군집조성에 대한 정보를 제공하고자 PCR-DGGE 기법을 사용하였다. 그 결과 우점 개체군들을 밝히고 그들과 알려진 PRB와의 계통관계를 분석하였다.
재료 및 방법
- 농화배양(enrichment culture)과 시약
PRB 농화배양은 문헌 [8] 에 언급된 것과 같이 25℃에서 실시하였다. 농화배양 초기에 mineral medium (pH 7.43), 원소 황 입자(70 g/l), 그리고 ClO 4 를 포함하는 반응기에 활성슬러지를 접종하였다. ClO 4 농도는 ClO 4 stock 주입으로 반응기 내에 약 120 mg/l으로 조절하였다. 반응기 내의 ClO 4 농도가 검출한계 이하로 낮아질 때마다 ClO 4 stock을 주입하여 spiking하면서 5년 이상 배양하였다. Mineral medium의 조성(l 당)은 다음과 같다: 2 mg MgSO 4 ·7H 2 O, 47 mg K 2 HPO 4 , 27 mg NaH 2 PO 4 ·H 2 O, 16 mg NH 4 H 2 PO 4 , 1 g NaHCO 3 . 배지는 탈염소처리된 수돗물을 사용하여 제조하였다. Mineral medium 내 용존유기탄소(dissolved organic carbon; DOC)는 TOC analyzer (GE Sievers InnovOx TOC analyzer)로 분석하여 검출한계(50 μg/l) 이하임을 확인하였다. 새 mineral medium은 한 달에 한번 교체하였고 pH는 일주일에 한번 측정하여 약 7.5로 조정하였다.
본 연구에 사용된 sodium perchlorate (NaClO 4 , 순도 > 99%)는 ACROS Organics (New Jersey, USA)에서 구입하였다. 한편 입자상 원소 황(S 0 , 순도 > 99.98%; 지름 2 - 3 mm)은 ㈜미원상사 (한국, 울산)에서 구입하였다. 그 외 시약들은 모두 Sigma-Aldrich Chemical Company, Inc. (St. Louis, MO, USA)에서 구입하였으며 가장 순도(순도 > 99%)가 높은 것이었다.
- 화학분석
반응기의 상등액을 문헌 [8] 에서와 같이 주기적으로 채취하여 ClO 4 농도와 pH를 분석하였다. 채취한 시료는 syringe filter (pore size, 0.22 μm)로 여과 후 ion chromatography (IC)로 ClO 4 농도를 분석하는데 사용하였다. IC 분석은 EPA METHOD 314.0 [21] 을 수정한 방법 [7] 을 사용하여 ClO 4 분석을 하였다. Analytical column AS16 (Dionex, USA)과 guard column AG16 (Dionex, USA)이 장착된 IC (Dionex ICS-1100; Sunnyvale, CA, USA)을 사용하였으며 ClO 4 의 검출한계는 0.62 μg/l이었다. IC 분석에 사용한 표준시약은 AccuStandard Inc. (New Haven, CT, USA)에서 구입하였다. ClO 4 제거효율은 식 4에 의해 계산하였다:
PPT Slide
Lager Image
- Genomic DNA 추출
농화배양 반응기에서 황 입자를 채취하고 그 입자에 형성된 생물막 미생물로부터 DNA를 추출하였다. 채취한 황 입자 시료에 phosphate buffered saline (pH 7.2)을 넣어 5분간 강하게 vortex하여 생물막 미생물을 황 입자로부터 유리시켰다. 유리된 미생물을 회수하여 UltraClean ® Microbial DNA isolation kit (MO BIO Laboratories, Inc.; Carlsbad, CA, USA)를 이용하여 genomic DNA를 추출하였다. 한편 농화배양된 미생물 군집과 비교하기 위해 접종균으로 사용된 활성 슬러지로부터 DNA를 추출하였다.
- 16S rRNA 유전자의 PCR 증폭
추출한 DNA는 문헌 [1] 에서와 같이 PCR에 주형으로 이용하여 16S rRNA 유전자 단편을 증폭하는데 사용하였다. 프라이머로서 GC clamp-341F와 518R를 이용하여 약 194 bp의 PCR 산물을 생성하였다. 이 두 프라이머의 염기서열은 다음과 같다: GC clamp-341F, 5′CGCCCGCCGCGCGCGGCGGGCGGGGCGGGGGCACGGGGTACGGGAGGCAGCAG-3‘; 518R, 5’-ATTACCGCGGCTGCTGG-3‘.
PCR 반응은 Prime Taq Premix (GENET BIO, Korea)를 이용하였고 touchdown PCR을 수행하였다. Annealing 온도를 초기 65℃로 한 후 55℃가 될 때까지 한 cycle마다 0.5℃씩 감소하게 하였다. 이러한 조건으로 20 cycles 증폭한 후, 다시 94℃, 1분, 55℃에서 1분, 72℃에서 1분 간 5 cycle 추가로 증폭한 후 72℃에서 5분 간 최종 신장하였다. 생성된 PCR 산물은 1.5% agarose gel에서 전기영동하여 UV-transilluminator로 증폭여부를 확인하였다.
- Denaturing Gradient Gel Electrophoresis (DGGE) 분석
PCR을 통해 증폭된 16S rRNA 유전자 단편은 DGGE에 사용하였다. DGGE는 문헌 [1] 에 기술된 것과 같이 실시하였다. Denaturing gel은 10% (w/v) polyacrylamide gel (acrylamide: N, N’-methylenebisacylamide, 37.5:1)에 변성제로서 formamide와 urea를 첨가하여 40%에서 60%까지 농도구배가 형성되도록 제작하였다. 이 농도구배 gel에 PCR 산물을 loading한 후 TAE buffer (40 mM Tris, 20 mM acetic acid, 1 mM EDTA, pH 8.0)에서 DCode systems (Bio-Rad)을 이용하여 60℃, 200 V에서 4시간 동안 전기영동을 실시하였다. 전기영동 후 gel을 EtBr로 염색하고 UV transilluminator에서 band의 패턴을 확인하였다.
- 염기서열 및 계통분석
DGGE에서 나타난 주요 DNA band는 문헌 [1] 에서와 같이 회수하여 염기서열을 결정하는데 사용하였다. 결정된 염기서열 정보는 GenBank database에 등록하였고, BLASTN (version 2.2.31+)을 이용하여 NCBI에 등록된 가장 유사한 염기서열을 찾는데 사용하였다 [2] . 검색 결과를 토대로 하여 유연 미생물들의 16S rRNA 유전자 염기서열을 수집한 후 Clustal W program를 사용하여 multiple alignment를 실시하였다 [12] . Multiple alignment의 결과를 MEGA 6.0 [20] 을 이용하여 neighbor-joining법으로 계통수를 작성하였으며 bootstrap은 1,000번 수행하였다.
결과 및 고찰
- 농화배양 미생물에 의한 ClO4−생분해
농화배양된 미생물의 ClO 4 제거 활성을 먼저 확인하고 미생물 군집조성을 분석하기 위한 생물막 시료를 채취하였다. ClO 4 제거 활성분석 결과는 Fig. 1 과 같다. 일주일 간격으로 채취한 배양액을 IC로 분석하여 ClO 4 농도 감소를 확인하고, ClO 4 stock을 재주입(respiking)하여 배양액에서 최종 농도가 약 120 mg ClO 4 /l가 되도록 하였다. 농화배양 미생물의 ClO 4 제거 효율은 7일 후 분석한 결과 99.71% 이상을 나타내었다.
PPT Slide
Lager Image
Perchlorate removal by the enrichment culture. Arrows represent respiking of perchlorate.
배양 시간이 지남에 따라 농화배양액의 pH가 점차 감소하는 것으로 나타났다( Fig. 1 ). 이것은 물에서 원소 황이 산화되거나(식 2) ClO 4 가 PRB에 의해 분해될 때 황이 산화되면서 수소 이온(H + )이 생성되기 때문이다(식 3). 따라서 원소 황을 전자공여체로 사용하여 ClO 4 를 제거할 경우 주기적으로 pH를 중성으로 조정해줌으로써 농화배양 미생물의 ClO 4 제거활성에 저해를 주지 않도록 하는 것은 중요하다. 본 연구에 사용된 농화배양 미생물은 회분배양시 초기 pH가 6.35보다는 pH 7.43과 pH 8.23에서 제거활성이 더 좋은 것으로 보고되었다 [8] . Gao 등 [6] 은 하수처리장의 혐기조에서 채취한 슬러지를 식종하고 전자공여체로서 원소 황을 사용하여 농화배양하였다. 농화배양된 미생물을 초기 pH를 달리하여 회분배양으로 ClO 4 제거효율을 비교한 결과 pH 7에서 제거효율이 가장 높았고 그 다음이 pH 6과 pH 8순으로 나타났다고 보고하였다.
- PCR-DGGE에 의한 미생물 군집비교
황을 산화하면서 ClO 4 를 분해하는 미생물들은 황 입자 표면에 생물막을 형성하면 황 입자로부터 쉽게 전자를 얻을 수 있으므로 물질 전달면에서 이점이 있는 것으로 여겨진다. 이전 연구 [7] 를 통해 실제로 황 입자표면에 형성된 생물막을 SEM을 이용하여 관찰하였다. 본 연구에서는 이 생물막 미생물의 군집조성을 파악하고자 PCR-DGGE를 실시하였다. 식종균으로 이용한 활성슬러지와 황을 전자공여체로 이용하는 농화배양 미생물의 16S rRNA유전자를 PCR로 각각 증폭하고 그 증폭 산물을 DGGE로 분석하였다. DGGE 결과로 나타나는 band 패턴을 비교함으로써 시료 내 미생물 군집을 비교하고 우점종을 파악하였다.
DGGE 결과 농화배양된 미생물 군집의 밴드패턴은 식종균의 그것과는 다른 것으로 나타났다( Fig. 2 ). 식종에 사용된 활성슬러지의 미생물 군집에 비해 더 진하고 구별되는 밴드들이 농화배양 시료에서 관찰되었다. 이는 식종된 미생물 군집이 농화배양 되는 동안 그 환경조건에 잘 생장하는 미생물들로 군집이 바뀐 것으로 여겨진다.
PPT Slide
Lager Image
DGGE profile of 16S rRNA gene fragments. The fragments were PCR-amplified from the total DNA extracted from activated sludge (lane 1) used as inoculums and from biofilm (lane 2) formed on sulfur particles taken from the enrichment culture. Arrows indicate DNA bands that were excised and analyzed for nucleotide sequences.
DGGE 결과( Fig. 2 ) 활성슬러지 미생물 군집에 비해 농화배양 미생물 군집에서 구별되는 진한 bands a - f를 잘라낸 후 PCR로 증폭하여 염기서열 분석을 실시하였다. 확보된 염기서열은 BLASTN 분석을 통해 염기서열이 가장 비슷한 것을 검색하였다. GenBank 데이터베이스에 등록된 염기서열 중에서 이들 bands와 유사성이 가장 높은 것은 모두 환경시료로부터 직접 클론된 16S rRNA 유전자들이었다. 이 시료들은 본 연구에 사용된 시료가 분리된 환경과 비슷한 혐기성/무산조 조건이거나 황을 산화하는 환경에서 분리되었다. 염기서열 분석결과 세 bands (a, c, 그리고 d)는 β- Proteobacteria 강에 속하고, 한 band (b)는 Bacteroidetes 강에 해당되었으며, 그리고 두 bands (e 와 f)는 Spirochaetes 강에 속하는 것으로 나타났다( Table 1 ). Band e와 f는 Spirochaetaceae 과 세균의 16S rRNA 유전자 클론과 가장 유사한(각각 99%) 것으로 나타났는데 이 두 bands의 염기서열은 서로 99% 유사성을 나타내었다.
Characteristics of 16S rRNA gene fragments obtained from DGGE gel
PPT Slide
Lager Image
Characteristics of 16S rRNA gene fragments obtained from DGGE gel
최근 Gao 등 [6] 은 하수처리장의 혐기조에서 채취한 슬러지를 식종하여 황을 산화하여 ClO 4 분해하는 농화배양을 135일간 실시 후 농화된 미생물을 PCR-DGGE로 분석한 결과, 식종된 슬러지의 군집 조성이 변화되었다고 보고하였다. 식종된 슬러지에 있던 일부 개체군들은 배양되는 동안 점차 농도가 낮아졌고, 반면에 슬러지에서 농도가 매우 낮았던 Methylobacterium fujisawaense , Tistrella bauzanesis , Hyphomicrobium sp., Zoogloea caeni , Stenotrophomonas maltophilia 등은 농화배양되는 동안 점차 우세하게 나타나 이러한 미생물들이 황을 전자공여체로 이용하여 ClO 4 를 분해하는 공정에 관련된 것으로 추정하였다. Sahu 등 [18] 은 황을 이용하여 ClO 4 를 연속 제거하는 반응기 내의 미생물 군집을 PCR-DGGE로 분석한 결과 ε- Proteobacteria 에 해당하는 Sulfuricurvum 속 세균이 우점종으로 나타났다고 보고하였다.
- 농화배양 미생물의 계통학적 분석
이화(dissimilatory)반응에 의해 ClO 4 를 분해하는 세균은 계통학적으로 주로 α-, β-, γ-, 그리고 ε- Proteobacteria 에 속하고 예외적으로 Firmicutes 강에 속하는 2 균주가 보고되었다 [3 , 4] . 특히 β- Proteobacteria 강에 보고된 PRB의 대부분이 속하는 것으로 알려졌다. 이 강에서도 PRB는 주로 Rhodocyclaceae 과에 해당되는 Dechloromonas 속과 Azospira 속에 해당된다고 알려졌다.
본 연구의 DGGE 결과 농화배양에서 우세한 16S rRNA 유전자( Fig. 1 Table 1 )와 보고된 PRB간의 계통학적 분석을 한 결과는 Fig. 3 에 제시된 계통수와 같다. 계통수에서 본 연구의 band a, c, 그리고 d가 β- Proteobacteria 강 clade에 속하였고, 이 중 band c가 Rhodocyclaceae 과에 해당되는 것으로 나타났다. 한편 α- Proteobacteria 강에 속하는 PRB로는 Dechlorospirillum sp. WD와 Azospirillum sp. TT1이 알려졌고, γ- Proteobacteria 강에 해당되는 PRB로는 Pseudomonas putida ASK1, Dechloromarinus chlorophilus NSS, 그리고 Citrobacter amalonaticus 가 보고되었으며 Wolinella succinogenes HAP-1은 ε- Proteobacteria 에 속하는 것으로 알려졌다 [3 , 4] .
PPT Slide
Lager Image
Phylogenetic relationship of the 16S rRNA genes detected by DGGE and closely related nucleotide sequences from GenBank. Neighbor-joining algorithm was used to construct the phylogenetic tree. The 16S rRNA gene of Methanobacterium formicicum was used as outgroup. Numbers at the nodes are bootstrap values obtained from 1,000 replicates. Scale bar indicates 50 inferred nucleotide substitutions per 1,000 nucleotides. Nucleotide sequence accession numbers are shown in parentheses.
본 연구의 DGGE 결과 우세한 개체군들 중에 Bacteroidetes 강과 Spirochaetes 강에 속하는 것들이 나타난 것은 흥미롭다. Spirochaetes 강에 해당하는 일부의 균주는 혐기적 조건에서 황을 산화하는 미생물로 알려졌다 [9] . 그러나 이 두 강에 해당하는 PRB들은 아직 보고된 것이 없다. Gao 등 [6] 은 황 산화 반응으로 ClO 4 를 제거하는 회분 반응기에서 채취한 시료를 DGGE로 분석한 결과 우세한 밴드 중에 Proteobacteria 뿐만 아니라 Bacteroidetes 강에 해당하는 16S rRNA 유전자 염기서열도 검출되었다고 보고하였다. 본 연구에서 DGGE 분석을 통해 도출된 결과에서 우점종으로 밝혀진 개체군들은 향후 순수분리와 더불어 황 산화를 통한 ClO 4 분해 환경에서 이들의 대사적 역할을 규명할 필요가 있다. 이들 미생물에 대한 연구가 이루어진다면 본 공정을 모니터링하고 제어하는데 큰 도움이 될 것으로 여겨진다.
Acknowledgements
이 논문은 동아대학교 교내 연구비 지원에 의하여 연구되었습니다.
References
Ahn Y. , Park E. J. , Oh Y. K. , Park S. , Webster G. , Weightman A. J. 2005 Biofilm microbial community of a thermophilic trickling biofilter used for continuous biohydrogen production FEMS Microbiol. Lett. 249 31 - 38    DOI : 10.1016/j.femsle.2005.05.050
Altschul S. F. , Madden T. I. , Schifer A. J. , Zhang J. , Zhang Z. , Miller W. , Lipman D. J. 1997 Gapped BLAST and PSI-BLAST: a new generation of protein database search programs Nucleic Acids Res. 25 3389 - 3402    DOI : 10.1093/nar/25.17.3389
Bardiya N. , Bae J. H. 2011 Dissimilatory perchlorate reduction: a review Microbiol. Res. 166 237 - 254    DOI : 10.1016/j.micres.2010.11.005
Coates J. D. , Achenbach L. A. 2004 Microbial perchlorate reduction: Rocket-fuelled metabolism Nat. Rev. Microbiol. 2 569 - 580    DOI : 10.1038/nrmicro926
Feng Y. , Xu Y. , Yu Y. , Xie Z. , Lin X. 2012 Mechanisms of biochar decreasing methane emission from Chinese paddy soils Soil Biol. Biochem. 46 80 - 88    DOI : 10.1016/j.soilbio.2011.11.016
Gao M. , Wang S. , Jin C. , She Z. , Zhao C. , Zhao Y. , Zhang J. , Ren Y. 2015 Autotrophic perchlorate reduction kinetics of a microbial consortium using elemental sulfur as an electron donor Environ. Sci. Pollut. Res. 22 9694 - 9703    DOI : 10.1007/s11356-015-4147-x
Han K. R. , Kang T. H. , Kang H. C. , Kim K. , Seo D. H. , Ahn Y. 2011 Autotrophic perchlorate-removal using elemental sulfur granules and activated sludge: batch test J. Life Sci. 21 1473 - 1480    DOI : 10.5352/JLS.2011.21.10.1473
Han K. R. , Ahn Y. 2013 Characterization of perchlorate-removal using elemental sulfur granules and activated sludge J. Life Sci. 23 676 - 681    DOI : 10.5352/JLS.2013.23.5.676
Karavaiko G. I. , Dubinina G. A. , Kondrat’eva T. F. 2006 Lithotrophic microorganisms of the oxidative cycles of sulfur and iron Microbiology 75 512 - 545    DOI : 10.1134/S002626170605002X
Kim H. , Kim J. , Lee Y. 2007 Occurrence of perchlorate in drinking water in Korea J. Kor. Soc. Water Quality 23 822 - 828
Kim H. , Kim J. , Lee Y. , Lee J. , Kim S. 2008 Perchlorate in advanced drinking water treatment process J. Kor. Soc. Water Quality 24 164 - 168
Larkin M. A. , Blackshields G. , Brown N. P. , Chenna R. , McGettigan P. A. , McWilliam H. , Valentin F. , Wallace I. M. , Wilm A. , Lopez R. , Thompson J. D. , Gibson T. J. , Higgins D. G. 2007 Clustal W and Clustal X version 2 Bioinformatics 23 2947 - 2948    DOI : 10.1093/bioinformatics/btm404
Lee C. 2009 Optimum treatment of sewage and wastewater discharged in Gumi industrial complex. Final report Gyeongbuk regional environment technology development center Gyeongbuk, Korea
Merlino G. , Rizzi A. , Schievano A. , Tenca A. , Scaglia B. , Oberti R. , Adani F. , Daffonchio D. 2013 Microbial community structure and dynamics in two-stage vs single-stage thermophilic anaerobic digestion of mixed swine slurry and market biowaste Water Res. 47 1983 - 1995    DOI : 10.1016/j.watres.2013.01.007
Motzer W. E. 2001 Perchlorate: problems, detection, and solutions Environ. Forensics 2 301 - 311    DOI : 10.1006/enfo.2001.0059
Nocker A. , Burr M. , Burr A. K. 2007 Genotypic microbial community profiling: a critical technical Review Microbiol. Ecol. 54 276 - 289    DOI : 10.1007/s00248-006-9199-5
Republic of Korea Ministry of Environment. 2010 Guideline for the management of drinking water quality monitoring items
Sahu A. K. , Conneely T. , Nüsslein K. R. , Ergas S. J. 2009 Biological perchlorate reduction in packed bed reactors using elemental sulfur Environ. Sci. Technol. 43 4466 - 4471    DOI : 10.1021/es900563f
Shin K. H. , Son A. , Cha D. K. , Kim K. W. 2007 Review on risks of perchlorate and treatment technologies J. Kor. Soc. Environ. Eng. 29 1060 - 1068
Timura K. , Stecher G. , Peterson D. , Filipski A. , Kumar S. 2013 MEGA6: Molecular evolutionary genetics analysis version 6.0. Mol. Biol. Evol. 30 2725 - 2729    DOI : 10.1093/molbev/mst197
US EPA 1999 EPA METHOD 314.0: Determination of perchlorate in drinking water using ion chromatography