Advanced
Identification of Genes Differentially Expressed by Oryctes rhinoceros nudivirus Infection in the Korean Rhinoceros Beetle, Allomyrina dichotoma
Identification of Genes Differentially Expressed by Oryctes rhinoceros nudivirus Infection in the Korean Rhinoceros Beetle, Allomyrina dichotoma
Journal of Life Science. 2015. Aug, 25(8): 942-946
Copyright © 2015, Korean Society of Life Science
This is an Open-Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/3.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.
  • Received : July 07, 2015
  • Accepted : July 31, 2015
  • Published : August 30, 2015
Download
PDF
e-PUB
PubReader
PPT
Export by style
Share
Article
Author
Metrics
Cited by
TagCloud
About the Authors
기상 권
보경 유
현우 서
영화 고
홍근 김
석현 이
관호 박
지영 최
오유 권
oykwon@cnu.ac.kr

Abstract
장수풍뎅이(Korean Rhinoceros Beettle, Allomyrina dichotoma )는 관상용으로 인기가 높으며, 애벌레는 식품으로 주목을 받고 있다. 장수풍뎅이의 대량사육 시 발생하는 질병의 원인이 최근에 virus ( Oryctes rhinoceros nudivirus )인 것이 보고되었다. 그러나 아직 정확한 발병기전과 치료방법을 알지 못하여 사육농가에 심각한 경제적 손실을 주고 있다. 본 연구에서는 virus에 감염된 장수풍뎅이의 fat body와 장에서 심각한 조직변화가 관찰되었다. 이 때에 유전자발현이 상승하는 것으로 BTF3H4-like, SPS-like, COPB1, T-CP, HSP70 를 보고한다. 이 결과는 장수풍뎅이의 대량사육 시 발생하는 질병의 조기진단과 치료에 실마리를 제공할 것이다. 그리고 안정적인 생산성 향상을 통해서 소득증대 효과 및 균일화된 대량사육을 통해서 식품원료로 인정받을 수 있을 것이다.
Keywords
서 론
2014년 현재 국내 곤충 산업의 시장 규모는 2,000억 원 정도. 곤충 사육 농가는 약 500곳으로 추산된다. 2015년에는 3,000억원을 넘을 것으로 예상된다. 단백질 공급원, 소자본·작은 공간에서 사육가능, 강한 번식력, 상대적으로 쉬운 사육관리, 대량살상의 윤리문제 회피, 온실가스와 자원비용 절감 등의 장점을 가지고 있어 곤충산업은 미래 녹색생명산업으로 주목을 받고 있다 [9] . 그러나 곤충의 산업화가 진행되면서 건강한 곤충의 대량사육이 요구되고 있다. Virus에 의한 백강병(white muscardine), 녹강병(green muscardine), 고름병, bacteria에 의한 물렁물렁병등과 함께 fungus, 원충(protozoa), 선충(nematoda), 응애(mites) 등에 의해서 대량 집단사육 시 질병 발생이 발생하여 대규모 피해가 만성적으로 발생하고 있다 [6] . 그 동안에 농진청에서 진단/판별 kit, 병 유발 유전자탐색, 친환경 방제법을 발전시켜오고 있다. 그러나 정밀한 진단 및 치료법이 개발되지 않은 상태이다.
장수풍뎅이(Korean rhinoceros beetle, Allomyrina dichotoma )는 사육되는 대표적인 곤충이다. 한국을 포함한 동남아시아 등지에 분포하는 장수풍뎅이의 전체 몸길이는 30-85 mm로 매우 단단한 외피에 싸여있다. 몸 색깔은 전체적으로 흑밤색을 띤다. 수컷은 반짝이는 광택이 나며 머리에 긴 뿔이 나 있는데, 그 길이가 몸길이의 절반 정도이다. 이들은 주로 낮에는 어두운 썩은 나무속 혹은 땅 속에 숨어 있다가 밤에 나와서 졸참나무( Quercus serrata ), 상수리나무( Quercus acutissima )의 수액을 먹는다. 6-8월에 짝짓기를 한 다음에 썩은 부엽토에 30~70개의 알을 낳는다. 유충은 일생 중 두 번 탈피를 한 뒤 월동하였다가 다음해 초여름에 땅 속에서 번데기가 되었다가, 15~20일 뒤에 성충으로 우화한다 [8] . 이들은 최근에 관상용으로 인기가 높으며, 특히 애벌레는 곤충식품으로도 주목을 받고 있다. 장수풍뎅이의 대량사육 시 발생하는 질병의 원인이 최근에 virus ( Oryctes rhinoceros nudivirus )인 것이 보고되었다 [5] . 그러나 아직 정확한 발병기전과 치료방법을 알지 못하여 사육농가에 심각한 경제적 손실을 주고 있다. 본 연구팀은 이 문제를 해결하기 위하여 virus에 감염된 장수풍뎅이의 장(intestine) 특이적으로 발현하는 유전자를 Differential Display (DD)-PCR방법으로 동정하였다. 장수풍뎅이의 질병 관련 유전자에 관한 보고는 본 논문이 최초이다. 이들 유전자에 대한 깊은 연구는 질병예찰과 치료에 도움을 줄 수 있는 실마리를 제공할 것이다. 이는 장수풍뎅이의 안정적인 대량생산을 통해서 생산성 향상과 소득증대 효과 및 균일화된 대량사육을 통해서 곤충식품원료의 품질관리 가능하게 할 것이다.
재료 및 방법
- 곤충사육 및 장(gut) 분리
본 연구에 이용된 장수풍뎅이는 표준 사육기준에 따라 사육된 3령 larvae를 경기도 시흥시 아이벅스캠프(영농조합법인)로부터 구입한 후, 약 25℃, 40%의 습도 조건의 발효 톱밥에 보관 하였다. 3령 larvae의 머리 부분을 해부침으로 고정시킨 후 표피를 아래에서 머리 방향으로 한 번에 가른다. Fat body를 제거한 후 장을 통째로 분리하여 장 내부의 톱밥 등의 내용물을 제거하고, 차가운 phosphate buffered saline (PBS)에 3회 세척하여 불순물질을 모두 제거 후 4% paraformaldehyde (PFA)로 고정 또는 total RNA를 분리하였다. Virus 감염유무는 아래의 primer를 사용하여 확인하였다. OrNV-F1; TCCGGAAATTACACGAGCCAC, OrNV-R1; ATGCCGTACGAGAGTATAGGTCG.
- H&E 염색
4% PFA에 고정한 장 조직을 흐르는 물에 충분히 수세하여 저농도에서 고농도의 에탄올에 순차적으로 담가 탈수시킨 후 자일렌을 이용하여 투명화하였다. 그 다음 파라핀으로 포매하고 마이크로톰을 이용하여 4 μm 두께로 잘라 슬라이드에 올린 후 파라핀을 제거하였다. Hematoxylin과 eosin을 이용하여 염색한 후 봉입하여 현미경으로 관찰하였다.
- RNA 분리
3 MM paper를 이용하여 수분을 제거한 조직을 1.5 ml tube에 넣고 500 μl의 RNA isolation buffer를 첨가하여 lysis 시킨 후 100 μl의 chloroform을 넣어 충분히 섞어주었다. 13,000 rpm, 4℃에서 10분 동안 원심분리하여 약 250 μl의 상등액을 취하여 새로운 tube에 옮긴 후 동량의 isopropanol을 첨가하였다. 실온에서 10분 정도 침전반응 유도한 후 13,000 rpm, 4℃에서 10분 동안 원심분리하고, 75% ethanol을 500 μl로 세척하여 total RNA을 얻어 RNase-free water로 녹인 후 nonodrop (Thermo Scientific, USA)을 이용하여 정량하였다.
- DD-PCR
GeneFishing DEG kit (Seegene, Korea)를 사용하여 PCR-based differential display 방법으로 선별하였다. Total RNA 3 μg과 dT-ACP1 oligomer 를 섞어 80℃에서 3분 동안 열변성시킨 후, 10x buffer, dNTP, MML-V, RNase inhibitor 등이 포함된 용액과 혼합하여 42℃에서 90분간 반응시켜 cDNA를 합성하였다. 이 cDNA를 주형으로 하여 dT-ACP2와 20가지의 arbitrary ACP를 이용하여 95℃에서 1분, 50℃에서 3분, 72℃에서 1분 동안 반응하여 double-strand cDNA 를 합성하였다. 그런 다음 94℃에서 30초, 65℃에서 30초, 72℃에서 1분씩 40회 반복한 후, 2% agarose gel에서 확인하였다. Target band를 오려서 Gel elution kit (ELPIS Biotech, Korea)를 이용하여 DNA를 회수한 후 pGEM-T easy vector (Promega, USA)를 이용하여 cloning 하였다. Plasmid miniprep kit (ELPIS Biotech, Korea)를 이용하여 DNA를 추출한 후 솔젠트회사에 의뢰하여 염기서열을 결정하였다(Solgent, Korea).
- RT-PCR
발현차이를 보인 유전자에 해당하는 primer를 이용하여 reverse transcription-PCR을 수행하였다. Total RNA 3 μg과 oligo-dT를 섞어 80℃에서 3분 동안 열 변성 시킨 후, 10x buffer, dNTP, MML-V, RNase inhibitor 등이 포함된 용액과 혼합하여 42℃에서 90분간 반응시켜 cDNA를 합성하였다. cDNA를 증폭시키기 위해서 해당 primer를 이용하여 95℃에서 30초, 56℃에서 30초, 72℃에서 30초로 28회 반응하여 전기영동으로 확인하였다. 사용된 primer는 다음과 같다. BTF3H4-like; F(5′-TACCGGATTTGGTGGAGAAC)/R(5′-CACATTCCCGACTGAAACAA), SPS; F(5′-GATGCATGCACGGGTGAC)/R(5′-GCAACCAAGACCCCATGTTA), COPB1; F(5′-GGCCACGTACGAGTTAGAGC)/R(5′-CATGCCTTAAATTGGCCTTT), T-cp1; F(5′-CGGGGAACTAGTCGAACAAA)/R(5′-CCATTTCCGAGGGTTTAGGT), Hsp70; F(5′-AAATCGGAAGAGGTGCAAGA)/R(5′-CAAGACGCCTGGTTGGTTAT), α-Tublin; F(5′-TGGTGTCCAACAGGTTTCAA)/R(5′-AAATCTTCACGGGCTTCTGA).
결과 및 고찰
Oryctes rhinoceros nudivirus 에 감염된 장수풍뎅이의 3령 larvae는 정상적인 것에 비하여 체장의 변화는 없다. 그러나 육안으로도 감염된 것은 몸 전체가 투명하지 않으며 진한 노란 색깔을 띤다. 가장 특징적인 것은 탈장을 확인할 수 있다( Fig. 1A ). 본 실험에서는 virus sequence를 이용하여 RT-PCR 방법으로 감염유무를 확인하였다( Fig. 1B ). 곤충의 fat body는 포유동물의 liver와 같이 지질대사와 해독작용에 관여하는 기관이다. 결국 virus감염에 의해서 fat body가 방어시스템을 작동하였기에 정상적인 fat body보다가 크게 팽창한 것으로 생각된다. 해부하여 각각의 fat body를 HE염색하여 현미경하에서 조직을 관찰하였다. Virus에 감염된 것의 fat body가 아주 팽창되어 있고 부분적으로 터져있는 것을 확인할 수 있었다( Fig. 1C ). 이와 같은 결과는 정상적인 신진대사가 일어나지 않아서 탈장이 유도되는 것을 생각된다. 이때에 장(intestine)의 구조적인 변화를 관찰하기 위하여 각각의 장을 HE염색하여 조직학적인 구조변화를 현미경하에서 관찰하였다. 정상적인 장구조에 비하여 virus감염된 장구조는 기저층에 있는 근육층(lamina musclaris)이 아주 얇아져 있고 점막(tunica musclaris)층이 빈약해져 있다. 그 결과 점액(mucin)을 분비하는 술잔세포(goblet cell)의 숫자가 현저히 감소되어 거의 관찰되지 않는다( Fig. 1D ). 점액은 산성단백질로 미세융모(microvillus)의 당질층(glycocalyx)에 보호막을 형성하여 상피(epithelium)표면을 윤활하게 하고 상피를 보호하는 역할을 담당하고 있다. 이처럼 virus감염에 의해서 장의 정상적인 기능이 작동할 수 없는 상태가 질병유발의 주요 원인인 것으로 생각된다.
PPT Slide
Lager Image
(A) Visual comparison of both a virus-infected larva (left) and a healthy larva (right). The virus-infected larva appears more yellowish than the healthy one, and its abdomen is swollen with an intestinal hernia. (B) Virus infection confirmed by RT-PCR. (C) Histological changes of the fat body from the virus-infected larva (left) and that from the healthy larva (right). Fat body infected by virus is swollen and partially exploded. (D) Histological changes of intestine from the virus-infected larva (left) and that from the healthy one (right). Intestine from the virus-infected larva shows weak lamina muscular compared to that from a healthy larva. Virus-infected epithelium glands almost lost its goblet cells. (E) The result of DD-PCR, arrows indicate differentially expressed DNA fragments.
장수풍뎅이가 Oryctes rhinoceros nudivirus 에 감염되었을 때에 장에서 일어나는 분자기전을 이해하기 위하여 DD-PCR방법을 이용하여, 특이적으로 발현하는 유전자를 탐색하였다. GeneFishing DEG kit (Seegene, Korea)는 포유동물의 특이유전자탐색에 사용되는 것이지만, 곤충을 상대로 했을 때에도 잘 적용되는 것을 확인하였다. Virus에 감염된 장과 비 감염된 장으로부터 total RNA를 얻어서 사용하였다. 그 결과 다수의 1차 결과를 얻었지만 reverse PCR결과 많은 false가 확인되었지만 특이적인 DNA단편이 확인되었다( Fig. 1E ). 그러나 Fig. 2 의 결과에서 보는 것과 같이 5개의 유전자는 virus감염에 의해서 특이적으로 발현이 상승하는 것이 확인되었다. BTF3H4-like (transcription factor BTF3 homolog 4-like)의 발현은 virus감염에 의해서 2이상 상승하였다. 그러나 이 단백질의 생체 내 기능은 아직 알려진 것이 없다. 단지 일반적인 유전자전사인자로서 RNA polymerase II complex와 안정적인 관계를 유지한다는 것 정도가 알려져 있다 [2] . SPS-like (serine proteinase stubble-like)의 발현은 virus감염에 의해서 3배 상승하였다. 이 단백질의 주된 생체내 기능은 serine-type endopeptidase활성을 가지고 있는 것으로 hormone 의존적으로 epithelial morphogenesis에 관여한다 [3] . COPB1 (coatomer protein complex, subunit beta 1)의 발현은 virus감염에 의해서 4배 증가하였다. Golgi-to-ER transport 시스템에 중요한 단백질로서 분비vesicles형성에 관여한다 [4] . T-CP (T-complex 1 subunit gamma)의 발현은 virus감염에 의해서 4배 상승한다. 이 단백질은 molecular chaperone으로서 ATP hydrolysis에 의해서 단백질의 folding을 돕는다, 특히 actin and tubulin folding에 중요하다 [1] . HSP70 (heat shock protein 70)의 발현은 virus감염에 의해서 6배 상승하였다. 어디에서나 발현하는 heat shock protein으로서 protein folding, 외부 스트레스로부터 세포보호에 중요한 역할을 한다 [7] .
PPT Slide
Lager Image
Five genes up-regulated by virus infection in the intestine. H; healthy intestine, D; Virus-infected intestine.
본 연구 결과는 장수풍뎅이(Korean Rhinoceros Beetle, Allomyrina dichotoma )가 Oryctes rhinoceros nudivirus 에 감염되면 fat body와 장에서 조직적인 구조변화가 일어나는 것을 관찰되었다. 이와 함께 장에서 특이적으로 발현이 상승하는 유전자로 BTF3H4-like, SPS-like, COPB1, T-CP, HSP70 를 보고한다. 이 결과는 장수풍뎅이의 대량사육 시 발생하는 질병의 조기진단과 치료에 새로운 기회를 제공할 것이다. 그리고 안정적인 생산성 향상을 통해서 소득증대 효과 및 균일화된 대량 사육을 통해서 식품원료로 인정받을 수 있을 것이다.
Acknowledgements
본 성과물(논문)은 농촌진흥청 연구사업(세부과제번호: PJ01086401)의 지원에 의해 이루어진 것임.
References
Bhaskar, Kumari N. , Goyal N. 2012 Cloning, characterization and sub-cellular localization of gamma subunit of T-complex protein-1 (chaperonin) from Leishmania donovani Biochem. Biophys. Res. Commun. 429 70 - 74    DOI : 10.1016/j.bbrc.2012.10.090
http://www.uniprot.org/uniprot/Q96K17
http://www.ncbi.nlm.nih.gov/gene/100158786
http://www.uniprot.org/uniprot/P53618
Lee S. , Park K. H. , Nam S. H. , Kwak K. W. , Choi J. Y. 2015 First report of Oryctes rhinoceros nudivirus (Coleoptera: Scarabaeidae) causing severe disease in Allomyrina dichotoma in Korea J. Insect Sci. 15
Manley R. , Boots M. , Wilfert L. 2015 Emerging viral disease risk to pollinating insects: ecological, evolutionary and anthropogenic factors J. Appl. Ecol. 52 331 - 340    DOI : 10.1111/1365-2664.12385
Mayer M. P. 2013 Hsp70 chaperone dynamics and molecular mechanism Trends Biochem. Sci. 38 507 - 514    DOI : 10.1016/j.tibs.2013.08.001
Suh H. J. , Kim S. R. , Lee K. S. , Park S. , Kang S. C. 2010 Antioxidant activity of various solvent extracts from Allomyrina dichotoma (Arthropoda: Insecta) larvae J. Photochem. Photobiol. B 99 67 - 73    DOI : 10.1016/j.jphotobiol.2010.02.005
van Huis A. 2013 Potential of insects as food and feed in assuring food security Annu. Rev. Entomol. 58 563 - 583    DOI : 10.1146/annurev-ento-120811-153704