Advanced
Fermentation Properties and Inflammatory Cytokines Modulating of Fermented Milk with Curcuma longa L Powder
Fermentation Properties and Inflammatory Cytokines Modulating of Fermented Milk with Curcuma longa L Powder
Journal of Life Science. 2015. Jan, 25(1): 75-83
Copyright © 2015, Korean Society of Life Science
This is an Open-Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/3.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.
  • Received : November 09, 2014
  • Accepted : January 12, 2015
  • Published : January 30, 2015
Download
PDF
e-PUB
PubReader
PPT
Export by style
Share
Article
Author
Metrics
Cited by
TagCloud
About the Authors
친핸드 렌
지윤 손
르가말 어
승희 백
조윤 이
명수 남
namsoo@cnu.ac.kr

Abstract
강황 ( Curcuma longa L.)은 건강기능성 식품의 훌륭한 소재로 전통적인 약용식물이다. 강황의 주요성분인 안토 시아닌계인 curcumin은 항균작용, 항암작용, 항산화작용 등 다양한 효능이 있는 것으로 알려져있다. 본 연구는 혼합유산균을 스타터로 사용하여 강황 분말을 첨가한 발효유를 제조하여 발효유의 이화학적 특성 및 항염증 활성을 연구하였다. 발효유의 발효특성은 대조군에 비해 강황 첨가군에서 유산균의 성장이 현저히 빠르게 나타나 pH는 감소되었고 산도는 증가하였다. 또한 우유단백질의 분해도 부분적으로 일어났고 유기산은 lactic acid와 acetic acid가 높게 생성되었다. 기호도는 강황 특유의 쓴맛과 강한 향으로 인해 대조군에 비해 낮았다. 강황 발효유 배양액을 처리한 RAW 264.7 세포주에서 세포독성의 영향은 나타나지 않았다. 염증성 싸이토카인으로 TNF-α와 IL-6 는 강황 처리군이 대조군에 비해 현저히 강하게 발현되었다. 또한 NO의 생성은 강황 처리군이 대조군에 비해 현저히 높았다. 이러한 연구결과는 강황 첨가가 유산균의 성장을 촉진시켜 발효유 제조에 도움을 주고, 염증활성을 조절하므로 강황을 이용한 발효유, 음료 제품 및 다양한 기능성 식품 소재로 활용할 수 있는 가능성을 시사하고 있다.
Keywords
서 론
강황( Curcuma longa L.)이 건강기능성 식품의 훌륭한 소재로 알려 지면서 소비자들의 관심이 높아지고 우리나라 남부지역에서 주로 강황을 경작하고 있다. 강황은 생강과에 속하는 다년생 초본식물로 학명은 Curcuma longa Longa Linne or Tumeric 으로 인도가 원산지이며 타이완, 인도네시아, 일본등의 일부 지역에서 재배되고 있고 자연이 준 독특한 향기와 맛, 그리고 천연의 색상과 다양한 특성을 가지고 있다 [2] . 강황(薑黃; Curcuma longa L)은 뿌리줄기의 식물로 껍질이 단단한 코르크 층으로 이루어져 있어 코르크 층을 제거한 후 내부 줄기성분을 사용한다 [18] . 강황의 주요성분 중 항균작용, 항암작용, 항산화작용 등 다양한 효능을 가지고 있는 정유성분인 안토시아닌계 천연염료로 curcumin이 함유되어 있고, zingiberone, tumerone, cineol 등이 미량으로 함유되어 있다. 강화에 함유된 무기물 중에는 K이 가장 많고 Na, Ca, Ti, Li, Cu 순으로 다양한 무기성분들이 함유되어있다 [19] . 강황은 독특한 향기와 맛, 천연의 황색을 가진 특성 때문에 예전부터 민간에서 강황주, 강황차, 강황음료, 강황카레, 강황면 등의 식품으로 이용되어 왔다. 강황에 대한 생리활성 기능연구는 항균작용 [10] , 항산화작용 [7 , 9] , 혈압강하작용 [16] , 비만억제작용 [20] , 항염증 [3] 등 다양한 효능이 알려졌다. 또한 강황을 식품에 이용한 연구는 설기 떡의 품질 특성 [11] , Sugar-snap 쿠키의 품질 특성 [4] , 쌀밥의 저장성에 미치는 영향[ 13] , 계육 소시지의 제조 조건 최적화 [23] , 두부의 저장성에 미치는 영향 [15] 등이 보고되었다. 본 연구는 강황을 이용한 발효유 제조 연구는 지금까지 보고된바 없기에 다양한 생리활성 기능이 있는 강황 분말을 첨가하여 발효유를 제조하여 발효유의 이화학적 특성 및 염증 관련 cytokine의 발현에 미치는 영향을 밝히고 기능성 식품 소재로 이용 가능성을 제시하고자 수행하였다.
재료 및 방법
- 공시재료 및 요구르트 제조
원유는 충남대학교 동물자원연구센터에서 착유한 신선한 원유를 사용하였으며, 강황(Jindo NH, Jindo, Korea)은 농협 하나로마트에서 구입하여 시료로 사용하였다. 요구르트의 제조는 원유에 강황을 0, 1, 2, 3%로 혼합한 후 85℃에서 10분간 열처리하고, 37℃로 냉각한 후 유산균은 상업용 혼합균주( Bifidobacterium bifidus, Streptococcus thermophilus, Lactobacillus acidophilus ) (Hansen, Hoersholm, Denmark)를 10% 탈지유(서울우유, Seoul, Korea)에 배양하여 스타터로 제조하여 2% 를 첨가하고 37℃에서 72시간 배양하였다.
- pH와 산도 측정
발효유의 배양 4시간 간격으로, 시료를 채취하여 pH 변화와 적정산도를 측정하였다. pH측정은 pH 측정기(S20 Seven-Easy TM pH, Mettler Toledo Inc. CH-8603, Schwerzenbach, Switzerland)를 사용하였다. 적정산도는 Dave and Shah(1998) 방법에 따라 시료 9 g에 증류수 9 ml와 phenolphtalein 지시약 0.5 mL을 첨가 한 후, 0.1 N NaOH로 적정하여 계산하였다.
- 유산균수 측정
배양 4시간 간격으로 유산균수는 10진 희석법으로 BCP (Brom Cresol Purple) (Eiken Chemical Co. Ltd., Tokyo, Japan) 고체 배지에 시료를 접종한 후 37℃에서 48시간 동안 배양한 후에 유산균수를 colony counter (Gallenkamp Co. Ltd., London, England)를 사용하여 조사하였다.
- 점도 측정
발효유의 배양 4시간 간격으로, 시료를 채취하여 점도변화는 점도계 (BM type, Tokimec Inc., Tokyo, Japan)를 이용하여 측정하였으며, spindle No. 1, 2, 3을 이용하여 60 rpm으로 1분 동안 측정하여 Centi Poise (cP)값으로 나타내었다. 발효유의 산도가 0.5%에 도달하였을 때 4℃ 냉장고에 24시간 냉각한 후 점도를 측정하였다.
- 전기영동
0, 24, 48, 72시간으로 배양한 발효유 시료를 채취하여 전기 영동을 Livia (1982)의 방법에 따라 시료 5 g을 5 ml 증류수와 혼합하고 0.1 N HCl를 이용하여 pH을 4.6으로 조정 후 5,000rpm으로 10분간 원심분리 하였으며, 침전된 시료는 casein으로 상층액은 유청단백질 시료로 분리하여 사용하였다 [14]. 투석막(Cellulose membrane M.W. 12,400; Sigma, St. Louis, MO, USA)을 이용하여 상층액은 4℃에서 3일 동안 투석시킨 후 동결건조기(IlShin Lab Co. Ltd, Siheung, Korea)를 사용하여 건조하였다. casein은 증류수로 3번 세척 후 1N NaCl을 이용하여 pH을 6.8로 조정 후 건조하여 sodium dodecyl sulphate- polyacrylamide gel electrophoresis (SDS-PAGE) 시료로 사용하였다. 강황 발효유의 유청단백질은 Schägger과 Jagow (1987)의 방법에 따라 Tricine SDS-PAGE을 수행하였다 [17] .
- 유기산 분석
24시간, 72시간 배양한 발효유 5 g 채취하여 12% TCA 용액을 1 ml 첨가하고 원심분리기(Mega 17R, Hanil Science Industrial, Incheon, Korea)를 사용하여 5,000× g에서 5 min 동안 원심분리 하였다. 분리된 상등액을 채취하여 0.2 μm membrane filter를 사용하여 여과한 후 HPLC system (600E Multisolvent Delivery System, Waters Associates, Milford, MA, USA)을 사용하여 유기산 농도를 분석하였다. 샘플은 7725 injector (Rheodyne, USA)를 사용하여 20 μl를 주입하였고, Detector는 Waters model 2487 Dual λ Absorbance Detector (Waters Associates, USA)를 사용하였고, Absorbance을 210 nm에 맞춰서 실시하였다. column은 SUPELCOGEL C-610H (38 cm × 7.8 mm, Sigma-Aldrich, St. Louis, MO, USA)을 사용하였고, column의 온도는 Waters Column Heater Module (serial #F98CHM095M)을 사용하여 40℃를 유지하였고, 이동상은 HPLC용 0.1% Phosphoric acid를 사용하여 0.5ml/min의 유속으로 30분 분석하였다. 분석프로그램은 Autochro-WIN 2.0 plus (Young Lin Instrument Co., Ltd., Anyang, Korea)를 사용하여 정량하였다.
- 관능 검사
강황을 0%, 1%, 2%, 3% 첨가한 발효유의 관능평가를 위하여 색(color), 향미(flavor), 단맛(sweetness), 텍스처(texture), 기호도 (overall preference)에 대하여 최저 1점에서 최고 5점으로 5단계 기호도 척도법으로 실시하였다. 관능검사에 사용된 시료는 24시간 배양한 발효유를 사용하였고, 관능평가요원은 연령은 20~25세, 남 11명, 여 9명을 대상으로 실시하였다.
- 세포 배양
수컷 BALB/c mouse의 복강내에 아벨슨 쥐 류케미아 바이러스를 주입해 생긴 복수종양으로부터 생성된 mouse macrophage cell line인 RAW 264.7 세포는 KRIBB (Daejeon, Korea)에서 분양 받았고 Dulbecco’s modified Eagle’s medium(DMEM)에 10% fetal bovine serum (FBS; Gibco, Rockville, MD, USA)과 1% (100 U/mg) penicillin/streptomycin(Sigma, St. Louis, MO, USA)을 첨가하고, 37℃, 5% CO 2 와 대기습도가 유지되는 배양조건에서 배양하였다. 24-well(Sigma, St. Louis, MO, USA)에 4×10 5 /ml 조정하여 24시간 배양 후 시료를 처리하였다. 세포주를 활성화 시키기 위해 1μg/ml의 lipopolysaccharide (LPS) (Sigma-Aldrich Co., St. Louis, MO, USA)를 처리하였다.
- Cell viability
강황 발효액이 RAW 264.7 세포에 미치는 세포독성 여부를 측정하기 위해 96 well에 1×10 4 cells/well이 되도록 분주하고 24시간 배양한 후에 강황 1%, 3% 첨가하여 72시간 배양한 발효유 상등액을 1/10 희석하고 0.5 μl/well를 처리하여 37℃, 5% CO 2 의 상태에서 24시간 배양하였다. 3-(4,5-methylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT; Sigma-Aldrich Co., St. Louis, MO, USA) 시약을 10 μl 처리하여 450 nm에서 ELISA reader (Promega, Madison, WI, USA)를 이용하여 측정하였다.
- Cytokine 측정
Raw 264.7 세포를 24-well (Sigma, St. Louis, MO, USA)에 4х10 5 /ml로 조정 후 LPS (Sigma Aldrich) 1 μg/ml을 처리하고, 대조군과 강황 1%, 3% 군으로 나누어 배양액을 50 μg/ml을 RAW 264.7에 처리하고, 6, 12, 24시간 배양 후 상층액을 모아 enzyme-linked immune-sorbent assay (ELISA) kit (BD Bioscience, Franklin Lakes, NJ, USA)를 이용하여 TNF-α와 IL-6를 측정하였고, NO는 배양 상층액 50 μl와 동량의 griess reagent (Sigma-Aldrich Co.)를 혼합하여 15분 후 540 nm에서 흡광도를 측정하였다.
- Cytokine의 PCR 분석
Cytokine 분석을 위해 배양한 세포를 회수하여 1 ml의 TRizol (Invitrogen Corporator, Carlsbad, CA, USA) 을 넣고 10분 동안 방치한 후 chloroform을 넣고 10초 동안 격렬하게 흔든 다음 12,000 rpm에서 15분 동안 원심분리하고 상층액을 취하여 동량의 isopropanol을 혼합하여 흔들어주었다. 12,000rpm에서 10분 동안 원심분리하여 상층액을 제거하고 pellet은 diethyl pyrocarbonate (DEPC) - DW 60 μl에 녹여 RT-PCR에 사용하였다. RT-PCR kits (Madison, WI, USA; Oligo dT, dNTP mix, Ribonuclease inhibitor, M-MLV Reverse Transcriptase, M-MLV RT 5x buffer)를 사용하여 45℃에서 30분, 94℃에서 5분 동안 반응시킨 후 94℃에서 30초 동안 denaturation시키고, 55∼62℃에서 30초 동안 annealing시킨 다음, 72℃에서 1분 동안 extension시키는 cycle을 24∼27회 반복한 뒤, 마지막 extension은 72℃에서 5분 동안 PCR (Applied Biosystems, Foster City, CA, USA) 을 수행하였다. 각 PCR산물은 2% agarose gel에 주입하고 100 V 조건에서 15분 동안 전기영동을 수행하였다. 사용한 primer는 glutaldehyde-3-phosphate dehydrogenase (GAPDH), 5’ CCATCACCATCTTCCAGGAG and 3’ACAGTCTTCTGGGTGGCAGT; IL-6, 5’ GATGCTACCAAACTGGATATAATC and 3’GGTCCTTAG-CCACTCCTTCTGTG; TNF-α, 5’ATGAGCACAGAAAGCATGATCCGC and 3’이다.
- 통계처리
본 시험 결과에 대한 통계분석은 MYSTAT statistical analysis program (ver 2.0, Korea)하고 IBM SPSS Statistics 21(version 21.0, IBM Co., USA)을 사용하여 평균, 표준편차 및 Duncan’s multiple range test를 이용하여 p <0.01 수준에서 유의적 차이를 검정하였다.
결과 및 고찰
- 강황 첨가 발효유의 pH, 산도, 유산균 수 및 점도
강황 첨가 요구르트의 pH, 산도, 점도 및 유산균 수는 Fig. 1 에 나타난 바와 같이 37℃에서 0, 4, 8, 12, 16, 24, 48, 72시간 배양하면서 측정하였다. pH의 변화 (A)는 배양 시작인 0 시간에는 pH 6.8로 시작하여 배양이 진행됨에 따라 pH가 급격히 낮아졌으며, 배양 8시간이 경과한 시점에 대조군은 pH 5.7이었으나 강황 1% 첨가군은 pH 4.9, 2%와 3% 첨가군은 pH 4.6으로 낮아져 강황 첨가군이 대조군에 비해 산생성이 상당히 빠른 것으로 나타났다. 배양 8~72시간 사이에 강황 1%, 2%, 3% 첨가군 모두 pH 4.6에서 4.2 사이를 유지하고 배양 종점인 72시간째는 강황 첨가군 모두 pH 4.1로 나타났다. 반면에 대조군은 배양 종점인 72시간째는 pH 4.4로 나타나, 강황 첨가군에 비해 pH의 저하 속도가 느린 것으로 나타나 강황 첨가가 발효에 영향을 주는 것으로 나타났다. 이러한 현상은 강황에 유산균의 성장을 촉진하는 어떤 성분이 있기 때문인 것으로 추정된다. 적정산도의 변화 (B)는 배양 시작인 0 시간에는 0.14 ~0.18로 시작하여 배양이 진행됨에 따라 적정산도는 높아졌는데, 배양 4~8시간 사이에는 적정산도가 급격히 증가하여 0.4~0.6으로 나타났다. 배양 시간이 경과함에 따라 대조군에 비해 강황 첨가군이 48시간 경과할 때까지 높게 증가하였고, 배양 종점인 72시간째는 강황 첨가군 2%, 3%와 대조군이 0.9로 나타났고, 강황 1% 첨가군은 적정산도 1로 나타났다. 따라서 배양 48시간까지는 대조군에 비해 강황 첨가군에서 적정산도가 높게 나타난 것으로 보아 강황 첨가가 산 생성에 영향을 주는 것으로 나타났다. 유산균 증식의 변화 (C)는 배양 시작인 0 시간에는 1.78×10 7 -2.99×10 7 cfu/ml로 시작하여 배양이 진행됨에 따라 유산균은 증가하였는데, 강황 첨가군이 대조군에 비해 배양 0~4시간 동안 급속히 증가하여 1.23×10 8 -1.92×10 8 cfu/ml으로 나타났고 배양 4시간부터 48시간까지는 2.15×10 8 -2.53×10 8 cfu/ml 전후를 유지함에 비해, 대조군은 배양 4~48시간에 걸쳐 4.33×10 7 -9.1×10 7 cfu/ml 사이로 나타나 강황 첨가가 유산균 증식에 상당한 도움을 주는 것으로 나타났다. 점도의 변화 (D)는 배양 시작인 0 시간에는 11~13 cP로 시작하여 배양 4~8시간이 경과한 시점에 대조군은 점도의 변화가 없었으나 강황 1% 첨가군은 194 cP, 2%와 3% 첨가군은 각각 366cP, 291 cP로 나타나 강황 첨가군이 대조군에 비해 점도의 증가가 빠른 것으로 나타났다. 대조군은 배양 16시간에 430 cp, 24시간에는 513 cp로 급속히 증가하였고, 48시간에는 456 cp로 낮아졌다가 배양 종점인 72시간에는 640 cp로 증가하였다. 강황 1, 2, 3% 첨가군 모두 배양 48시간까지는 대조군에 비해 높게 나타났고, 배양 종점인 72시간째는 강황 1% 첨가군이 740 cp이고 대조군과 2, 3% 첨가군은 모두 623~640 cp로 나타났다. 특이한 점은 강황 3% 첨가군은 배양 16시간 이후부터 대조군과 비슷한 경향의 점도를 보였는데 이는 강황의 밝혀지지 않은 생화학적 특성이 발효유의 점도에 영향을 주는 것으로 추측된다. 선형분석에서도 2%>1%>3%>대조군 순으로 나타났다.
PPT Slide
Lager Image
The changes of pH (A), titratable acidity (B), viable cell counts (C), viscosity (D) in fermented milk with turmeric powder by different concentrations during 72 hr at 37℃.
- 우유단백질 분해
발효과정에서 우유의 casein과 유청단백질의 분해는 Fig. 2 에 나타난 바와 같다. Fig. 2 (A) 는 casein의 분해를 전기영동으로 나타낸 것으로 대조군인 lane 1, 2, 3은 α-casein, β-casein, κ-casein의 분해는 거의 되지 않은 것으로 나타났지만, 강황 1% 첨가군인 lane 5 (24시간 배양)와 6 (72시간 배양)에서 casein의 분해가 진행되어 α-casein과 β-casein의 분해물 일부가 나타났다. 또한 강황 2% 첨가군인 lane 8 (24시간 배양)과 9 (72시간 배양), 강황 3% 첨가군인 lane 11 (24시간 배양)과 12 (72시간 배양)에서도 casein의 분해가 진행되어 α-casein과 β-casein의 분해물 일부가 확인되었다. Fig. 2 (B) 는 유청단백질의 분해를 Tricine Gel를 사용하여 나타낸 것으로 대조군인 lane 1, 2, 3은 β-LG과 α-LA의 위 아래에 있는 미량의 단백질은 분해는 일어나지 않았지만 강황 1% 첨가군인 lane 5 (24시간 배양)와 6 (72시간 배양)에서는 분해가 진행되었다. 또한 강황 2% 첨가군인 lane 8 (24시간 배양)과 9 (72시간 배양), 강황 3% 첨가군인 lane 11 (24시간 배양)과 12 (72시간 배양)에서도 β-LG과 α-LA의 위 아래에 있는 미량의 단백질은 분해가 진행되었다. 한편 Lactobacillus salivarius sp. salivarius 를 이용한 발효특성에서 casein의 분해는 미약하게 나타났지만, 유청단백질 중 α-LA의 분해는 상당한 수준으로 일어났다 [1] . 이와같이 강황의 첨가는 유산균의 활발한 증식을 도와줌으로써 단백질 분해 효소를 대사물질로 생산하는데 기여하는 것으로 확인되었다.
PPT Slide
Lager Image
Polyacrylamide gel electrophoresis pattern for casein of fermented milk with turmeric powder by different concentrations (A). M: molecular marker, 1: fermentation for 0 hr, 2: fermentation for 24 hr, 3: fermentation for 72 hr, 4: fermentation with 1% turmeric powder for 0 hr, 5: fermentation with 1% turmeric powder for 24 hr, 6: fermentation with 1% turmeric powder for 72 hr, 7: fermentation with 2% turmeric powder for 0 hr, 8: fermentation with 2% turmeric powder for 24 hr, 9: fermentation 2% turmeric powder for 72 hr, 10: fermentation with 3% turmeric powder for 0 hr, 11: fermentation with 3% turmeric powder for 24 hr, 12: fermentation with 3% turmeric powder for 72 hr. Tricine gel electrophoresis pattern for whey protein of fermented milk with turmeric powder by different concentrations (B). M: molecular marker, 1: raw milk for 0 hr, 2: fermentation for 24 hr, 3: fermentation for 72 hr, 4: fermentation with 1% turmeric powder for 0 hr, 5: fermentation with 1% turmeric powder for 24 hr, 6: fermentation with 1% turmeric powder for 72 hr, 7: fermentation with 2% turmeric powder for 0 hr, 8: fermentation with 2% turmeric powder for 24 hr, 9: fermentation 2% turmeric powder for 72 hr, 10: fermentation with 3% turmeric powder for 0 hr, 11: fermentation with 3% turmeric powder for 24 hr, 12: fermentation with 3% turmeric powder for 72 hr (B).
- 유기산 함량
Fig. 3 은 24시간 배양한 발효액에 포함된 유기산을 분석한 결과이다. A는 대조군, B는 강황 1% 첨가군, C는 강황 2% 첨가군, D는 강황 3% 첨가군을 나타낸 것으로 A, B, C, D 모두 배양 24시간, 72시간 경과함에 따라 oxalic acid와 citric acid는 거의 생성되지 않았고, tartaric acid는 대조군과 강황 첨가 함량에 따른 영향이 없이 35 mM 전후의 범위 내에서 생성되었다. lactic acid는 대조군은 생성되지 않음에 비해, 배양시간과 강황 첨가 함량이 증가함에 따라 급격히 생성되어 72시간 배양한 강황 3% 첨가군에서 189.24 mM이 생성되었다. acetic acid는 대조군에 비해 강황 첨가군 모두에서 급격히 증가하였는데, 배양 72시간째 보다는 24시간째가 가장 많은 361.39 mM이 생성되었다. 이와 같이 강황 첨가가 유산균의 증식에 도움을 줌으로써 lactic acid와 acetic acid의 생성을 촉진시키는 것으로 사료된다.
PPT Slide
Lager Image
The changes of organic acids at fermented milk with turmeric powder by different concentrations during 24 hr. A; Control, B; fermented milk with 1% turmeric powder, C; fermented milk with 2% turmeric powder, D; fermented milk with 3% turmeric powder. ①: oxalic acid, ②: citric acid, ③: tartaric acid, ④: malic acid, ⑤: malonic acid, ⑥: succinic acid, ⑦: lactic acid, ⑧: acetic acid
- 관능검사
Fig. 4 는 24시간 배양한 발효유의 관능검사를 실시한 결과로 대조군에 비해 강황 1%, 2%, 3% 첨가군 모두에서 color, flavor, sweetness, texture, overall preference가 낮게 나타났는데, 이는 강황 특유의 쓴맛과 강한 향이 영향을 미쳤기 때문으로 사료된다. 따라서 강황을 첨가한 발효유를 제조할 경우는 강황의 첨가량 조절과 감미료와 향미의 선택 등을 통하여 강황 특유의 쓴맛과 강한 향을 극복할 수 있으리라 생각한다.
PPT Slide
Lager Image
The sensory analysis of fermented milk with turmeric powder by different concentrations during 24 hr. C : 1% : 2% : 3% :
- 세포 생존률
세포독성 영향을 측정한 결과는 Fig. 5 에 나타난 바와 같이 RAW 264.7 대식세포에 대조군, 강황 1%, 2%, 3% 첨가군을 처리 한 후 세포생존율을 MTT assay로 확인하였다. 대조군을 100%로 하였을때 강황 3% 첨가군은 100%로 차이가 없었고, 양성대조군인 LPS (1 μg/ml)와 강황 1%, 2%를 처리한 군은 105-115%로 나타나 강황이 세포 성장을 억제하는 영향은 없는 것으로 나타났다.
PPT Slide
Lager Image
The concentration of expression of WST-1 in RAW 264.7. Supernatants of fermented milk with turmeric powder by different concentrations during 24 hr were treated to RAW 264.7. Incubation time in RAW 264.7 was 24 hr. Incubation time of fermented milk was 72 hr.
- TNF-α 및 IL-6의 발현 및 생산
Macrophage는 인체 전반에 걸쳐 분포하여 외부의 병원체로부터 인체를 방어하는 역할을 담당하며 활성화된 macro-phages는 내재면역 반응에 관련된 다른 세포들을 유인하고 활성화시키는 cytokine을 분비한다. 활성화된 대식세포에 의해 분비되는 TNF-α는 염증반응에 관련된 cytokine으로 면역반응을 증강시키고 이물질을 감염부위로 유인하는 방어작용을 하지만, 과도하게 생성될 때는 염증성 질환을 유발시킬 수 있다 [12] . 또한 IL-6은 일차면역반응 B 세포 성장 및 분화 인자로 작용하는데, 항원자극을 받아 증식된 B 림프구의 항체 생산과 분비에 중요한 역할을 담당하며 형질세포 항체분비 항진, T 세포 활성 보조 자극 등의 기능을 가진 것으로 알려져 있다 [8] . 이에 따라 본 연구에서는 대식세포를 활성화시켜 면역을 증진시키는 효과를 알아보기 위해 mouse macrophage cell line인 RAW 264.7 세포주를 이용하여 TNF-α 및 IL-6와 같은 염증관련 cytokine의 발현 정도를 확인하였으며, 또한 생산량도 측정하였다. Fig. 6 는 TNF-α 및 IL-6의 발현을 PCR을 통하여 분석한 것으로 TNF-α의 발현은 6시간, 12시간, 24시간 경과함에 따라 대조군에 비해 강황 1, 2, 3% 첨가군은 강하게 발현하였는데, 특히 2%와 3% 첨가군에서 배양 24시간째는 LPS 처리군과 유사하게 현저히 강하게 발현되었다. IL-6의 발현은 배양 6 시간째는 강황 1%와 2% 첨가군에서는 발현이 되지않았지만, 12시간째는 1%와 2% 첨가군에서 약하게 발현되었고 3% 첨가군에서 강하게 발현되었다. 배양 24시간째는 1, 2, 3% 첨가군 모두에서 LPS 처리군과 유사하게 현저히 강하게 발현되었다. Fig. 7 8 은 TNF-α 및 IL-6의 생성량을 나타낸 것으로, Fig. 6 에 나타난 바와 마찬가지로 TNF-α 및 IL-6의 생성량은 강황 1, 2, 3% 첨가군에서 생성량이 대조군에 비해 유의적으로 높게 나타났다. 따라서 강황 첨가군의 발효액은 TNF-α 및 IL-6의 발현에 크게 영향을 미치는 것으로 확인되었는데, 이는 강황 첨가 발효액이 염증 조절제로서의 가능성을 암시하고 있다. 한편 Aspergillus oryzas 를 이용하여 발효한 강황추출물을 RAW 264.7 세포에 처리하였는데, TNF-α의 생성은 LPS를 처리한 군에 비해 강황추출물 처리군이 유의적으로 낮았지만, 실온추출물 처리군에서는 1,313±254 pg/ml, 열수 추출물 처리군에서 1,256±150 pg/ml로 높게 생성되었다 [21] .
PPT Slide
Lager Image
The PCR analysis of TNF-α and IL-6 in RAW 264.7. Supernatants of fermented milk with turmeric powder by different concentrations during 24 hr were treated to RAW 264.7. Incubation time in RAW 264.7 was 6 hr, 12 hr and 24 hr. Incubation time of fermented milk was 72 hr.
PPT Slide
Lager Image
The concentration of expression of TNF-α in RAW 264.7. Supernatants of fermented milk with turmeric powder by different concentrations during 24 hr were treated to RAW 264.7. Incubation time in RAW 264.7 was 6 hr, 12 hr and 24 hr. Incubation time of fermented milk was 72 hr.
PPT Slide
Lager Image
The concentration of expression of IL-6 in RAW 264.7. Supernatants of fermented milk with turmeric powder by different concentrations during 24 hr were treated to RAW 264.7. Incubation time in RAW 264.7 was 6 hr, 12 hr and 24 hr. Incubation time of fermented milk was 72 hr.
- NO 발현
강황첨가 발효액에 의해 대식세포인 RAW 264.7이 생성하는 NO의 양을 알아보기 위해 생쥐 단핵구 기원의 RAW 264.7세포주를 이용하여 NO의 농도를 측정한 결과는 Fig. 9 에 나타난 바와 같다. 배양 6시간째는 NO 생성량이 대조군과 강황1, 2, 3% 첨가군 간에는 차이가 없었고, 배양 12시간째에서 대조군에 의해 생성된 NO의 농도는 18 μM, 양성대조군인 LPS 처리군은 31 μM, 강황 1, 2, 3% 첨가군의 농도는 각각 29, 33, 35 μM로 생성되어 실험군이 양성대조군인 LPS와 유사한 NO 생성량을 확인할 수 있었다. 배양 24시간째 대조군은 18 μM가 생성되었고, LPS 처리군은 62 μM, 강황 1, 2, 3% 첨가군의 농도는 각각 62, 70, 80 μM로 대조군에 비해 7배 이상의 NO의 생성량이 높게 나타났다. 따라서 강황 처리가 RAW 264.7 세포의 활성을 증가시켜 면역효과를 증진시키는 것으로 생각되고, NO와 TNF-α의 생성은 면역체계를 조절하는 중요한 역할을 한다고 볼 수 있다. 강황 발효물을 RAW 264.7 세포에 처리하였을 때 면역 활성의 지표가 되는 NO, cytokine(TNF-α, IL-1β, IL-6, IL-10)의 생성이 발효물을 처리하지 않은 대조군에 비해 시간이 지남에 따라 최대 8배 이상 증가되었다고 보고하였다 [22] . 또한 NO의 생성은 LPS를 처리한 군이 대조군에 비해 약 20배 많이 생성하였고 강황 실온추출물 처리군과 열수추출물 처리군에서는 대조군과 비슷한 수준으로 생성되었다 [21] . 이러한 결과는 본 연구에서 밝힌 LPS 처리군에서 NO의 높은 생성과는 유사한 결과였으나, 강황 1, 2, 3% 첨가군과 비교했을 때는 상반된 결과를 나타내었는데 이는 발효에 사용한 미생물의 종류가 다르고 실험재료인 강황의 처리 방법의 차이에 기인하는 것으로 사료된다.
PPT Slide
Lager Image
The concentration of expression of NO in RAW 264.7. Supernatants of fermented milk with turmeric powder by different concentrations during 24 hr were treated to RAW 264.7. Incubation time in RAW 264.7 was 6 hr, 12 hr and 24 hr. Incubation time of fermented milk was 72 hr.
Acknowledgements
본 연구는 2014년도 충남대학교 자체연구비 사업에 의해 수행되었으며, 이에 감사드립니다.
References
Bae H. C. , Nam M. S. , Lee J. Y. 2002 Probiotic characterization of acid- and bile tolerant Lactobacillus salivarius sp. salivarius from Korean Faeces Asian-Aust. J. Anim. Sci. 15 1798 - 1807    DOI : 10.5713/ajas.2002.1798
Cha Y. M. 2009 Influence that safflower and turmeric affects on hair dyeinh. MS. Dissertation Kwang Ju Girl University Kwang Ju, Korea
Chainani-Wu N. 2003 Safety and anti-inflammatory activity of curcumin. A component of turmeric (Curcuma longa) J. Altern. Complement. Med. 9 161 - 168    DOI : 10.1089/107555303321223035
Choi Y. S. , Lee M. H. , Jhee O. H. 2011 Quality characteristics of sugar-snap cookies by additions of Curcuma longa L. powder Kor. J. Culin. Res. 17 198 - 208
Dave R. I. , Shah N. P. 1998 Ingredient supplementation effects on viability of probiotic bacteria in yogurt J. Dairy Sci. 81 2804 - 2816    DOI : 10.3168/jds.S0022-0302(98)75839-4
Juan F. M. , Linda S. 1989 Milk protein typing of bovine mammary gland tissue used to generate a complementary deoxyribonucleic acid library J. Dairy Sci. 72 3190 - 3196    DOI : 10.3168/jds.S0022-0302(89)79477-7
Kim H. J. , Lee J. W. , Kim Y. D. 2011 Antimicrobial activity and antioxidant effect of Curcuma longa, Curcuma aromatic and Curcuma zedoaria Kor. J. Food Preserv. 18 219 - 225    DOI : 10.11002/kjfp.2011.18.2.219
Kim S. J. 1994 Immunology Korea Medical Publishing Seoul, Korea 119 - 131
Lee B. S. 2006 Extraction process of gingerol from ginger by ultrasonication and it’s antioxidant effect. MS. Dissertation Cheon Buk University Cheon Ju, Korea
Lee K. W. 2005 Antibacterial activity of the Zingiberaceae plant extract against microorganisms, MS. Dissertation Yonsei University Seoul, Korea
Lee M. H. , Jeon S. J. , Kim S. K. 2011 The quality characteristics of Curcuma longa L. powder Sulgitteok Kor. J. Culin. Res.
Lee M. H. 2008 Lippincott’s Illustrated Reviews : Immunology Shinilbooks Seoul, Korea 41 - 53
Lim Y. S. , Park K. N. , Lee S. H. 2007 Effects of turmeric (Curcuma aromatica Salab.) extract on shelf life of cooked rice Kor. J. Food Preser. 14 445 - 450
Livia A. 1982 Effect of fermentation on proteins of Swedish fermented milk products J. Dairy Sci. 65 1696 - 1704    DOI : 10.3168/jds.S0022-0302(82)82404-1
Park K. M. , Park L. Y. , Kim D. G. , Park G. S. , Lee S. H. 2007 Effect of turmeric (Curcuma aromatica Salab.) on shelf life of tofu Kor. J. Food Preser. 14 136 - 141
Park H. S. , Jeon T. W. , Choi H. S. , Kim J. M. , Kim M. K. 2011 Physiological activities of extracts from Fomitella fraxinea on brown rice added rice bran, pine needle and turmeric powder Kor. J. Mycol. 39 105 - 110    DOI : 10.4489/KJM.2010.39.2.105
Schägger H. , von Jagow G. 1987 Tricine-sodium dodecyl sulfate polyacrylamide gel electrophoresis for the separation of proteins in the range from 1-100 kD Anal. Biochem. 166 368 - 379    DOI : 10.1016/0003-2697(87)90587-2
Sung K. C. 2010 A study on the pharmaceutical characteristics and analysis of natural ginger extract J. Kor. Oil Chemists’ Soc. 27 266 - 272
Sung K. C. 2011 A study on the pharmaceutical & chemical characteristics and analysis of natural curcumin extract J. Kor. Oil Chemists’ Soc. 28 393 - 401
Yang C. Y. , Cho M. J. , Lee C. H. 2011 Effects of fermented turmeric extracts on the obesity in rats fed a high-fat diet J. Anim. Sci. Tech. 53 75 - 81    DOI : 10.5187/JAST.2011.53.1.75
Yoo S. A. , Kim O. K. , Nam D. E. , Kim Y. , Baek H. , Jun W. , Lee J. 2014 Immunomodulatory effects of fermented Curcuma longa L. extracts on RAW 264.7 cells J. Kor. Soc. Food Sci. Nutr. 43 216 - 223    DOI : 10.3746/jkfn.2014.43.2.216
Yu A. R. , Park H. Y. , Choi I. W. , Park Y. K. , Hong H.D. , Choi H. D. 2012 Immune enhancing effect of medicinal herb extracts on a RAW 264.7 macrophage cell line J. Kor. Soc. Food Sci. Nutr. 41 1521 - 1527    DOI : 10.3746/jkfn.2012.41.11.1521
Yun E. A. , Jung E. , Joo N. 2013 Optimized processing of chicken sausage prepared with turmeric (Curcuma longa L.) Kor. Food Cult. 28 204 - 211    DOI : 10.7318/KJFC/2013.28.2.204