Rice flour is used in many food products. However, dough made from rice lacks extensibility and elasticity, making it less suitable than wheat for many food products such as bread and noodles. The high-molecular weight glutenin subunits (HMW-GS) of wheat play a crucial role in determining the processing properties of the wheat grain. This paper describes the development of marker-free transgenic rice plants expressing a wheat Glu-Dy10 gene encoding the HMG-GS from the Korean wheat cultivar ‘Jokyeong’ using Agrobacterium-mediated co-transformation. Two expression cassettes, consisting of separate DNA fragments containing Glu-1Dy10 and hygromycin phosphotransferase II ( HPTII ) resistance genes, were introduced separately into Agrobacterium tumefaciens EHA105 for co-infection. Each EHA105 strain harboring Glu-1Dy10 or HPTII was infected into rice calli at a 3: 1 ratio of Glu-1Bx7 and HPTII . Among 290 hygromycin-resistant T ₀ plants, we obtained 29 transgenic lines with both the Glu-1Dy10 and HPTII genes inserted into the rice genome. We reconfirmed the integration of the Glu-1Dy10 gene into the rice genome by Southern blot analysis. Transcripts and proteins of the Glu-1Dy10 in transgenic rice seeds were examined by semi-quantitative RT-PCR and Western blot analysis. The marker-free plants containing only the Glu-1Dy10 gene were successfully screened in the T ₁ generation. Improvement of rice quality, especially that of rice flour is of great relevance to many Asian counties, where rice is widely cultivated, and rice flour has been used for many food products. However, dough made from rice lacks extensibility and elasticity. A probable cause is lack of proteins responsible for this trait in the rice endosperm. On the other hand, dough made from wheat flour is elastic and extensible making it suitable for many food products particularly for bread [26] . Transgenic rice with improved dough functionality by transformation of wheat gluten genes, such as high and low-molecular weight glutenin subunits, gliadins maybe substitute or complement wheat flour for making bread. Wheat flour is different from other cereal flours, including rice. The unique processing properties of wheat flour result from the unusual biomechanical properties of the gluten proteins, which form a network conferring elasticity and extensibility to the dough [5] . Gluten proteins consist of monomeric gliadins and polymeric glutenins. Gliadins are single chain molecules which form only intra-chain disulphide bonds. In contrast, the glutenin subunits form both interand intra-chain disulphide bonds. The high molecular weight glutenin subunits (HMW-GS) of wheat play an important role in determining the functional properties of wheat dough [19 , 20 , 27 , 29] . Bread wheat contains from three to six HMW-GS genes, with tightly linked pairs of genes encoding x- and y-type subunits being present at each of the Glu-A1, Glu-B1, and Glu-D1 loci on the long arms of chromosomes 1A, 1B, and 1D, respectively [21] . Allelic differences in the HMW-GS composition result in effects on the structures and properties of the glutenin polymers and hence on bread-making quality [22 , 28] . Glu-1Dy10 , one of the HMW-GSs in the D1 chromosome, consists of 648 amino acids and five cysteine residues in the C-terminal domain. The central domain has an additional cysteine residue that is present close to the end of the C-terminus in the y-type subunits and, occasionally, closes to the N-terminus in the x-type subunits. The y-type subunits are highly cross-linked with x-type subunits and enhance mixing strength and tolerance of dough. In particular, HMW-GS 1Ax1 and 1Dx5+1Dy10, encoded by chromosomes 1A and 1D, respectively, are associated with strong dough and good bread-making quality. Several HMW-GS genes have been shown to be functional when transformed into Escherichia coli [10] , tobacco [23] , wheat [1 , 2 , 5 , 6] and tritordeum [24] . The genetic engineering of transgenic plants in most crop species requires the use of selectable marker genes and selective agents, such as herbicides and antibiotics in order to minimize regeneration of non-transformed tissues. However, the presence of selectable marker genes in transgenic crops destined for field cultivation and human food leads to serious public concerns about the safety of transgenic crops, even though several risk-assessment reports [14 , 25] have shown that neither the genes nor their products are harmful to human or environmental health. Because combination of wheat gluten genes is important to make transgenic rice plants with good bread-making quality, transgene pyramiding of transgenic rice plants, which containing various wheat gluten genes is required. Repeated use of the same promoter and a polyadenylation signal for different selectable marker genes could result in transcriptional gene silencing [12] . Therefore, eliminating selectable marker genes is crucial for stacking multiple traits in a transgenic plant. Moreover, generating marker-free transgenic plants responds not only to public concerns over the safety of genetically engineered crops, but supports multiple transformation cycles for transgene pyramiding. In this study, we produced marker-free transgenic rice expressing the wheat HMW-GS protein, Glu-1Dy10 , without any herbicide or antibiotic resistance marker genes. The marker-free transgenic plant expressing Glu-1Dy10 gene is critical material for generating transgenic plant advanced quality processing of bread and noodle without antibiotic markers. ′Jokyeong′ ( Triticum aestivum L. cv. Jokyeong) was used for cloning the Glu-1Dy10 gluenin gene. The Glu-1Dy10 gene was amplified by polymerase chain reaction (PCR) of genomic DNA using the primers Glu-1Dy10-CF (primer sequences : 5′ - AGGGTACCGAGATGGCTAAGCGGCTGG - 3′) and Glu-1Dy10-CR (primer sequences: 5′- GATCTAGATCACTGGCTAGCCGACAATG -3′), which were designed from a sequence on GenBank (accession no. X12929). The PCR temperature cycling conditions were 4 min at 94°C, followed by 35 cycles of 94°C for 30 sec, 60°C for 30 sec, 72°C for 2 min, and a final extension at 72°C for 10 min. The amplification products were separated on a 1% agarose gel and visualized with EtBr. The amplified products were sub-cloned using a TOPO TA Cloning kit for sequencing (Invitrogen, Carlsbad, CA, USA). To make a marker-free vector, we amplified promoter region of high-molecular weight glutenin gene (Genbank accession no. AY795083.1) from wheat cultivar ′Jokyeong′. And then amplified promoter was inserted into the pBTEX binary vector, which modified from pCAMBIA1300 binary vector. The HPTII expression cassette ( CaMV 35S promoter- HPTII gene- CaMV 35S terminator) in the pBTEX binary vector was removed by XhoI and EcoRI restriction enzyme treatment. After klenow enzyme treatment for blunt ligation, the vector was self-ligated. Then, amplified the Glu-1Dy10 gene with the KpnI and XbaI restriction enzyme sites was constructed into pBTEX binary vectors under the control of HMW (high-molecular weight) glutenin promoter ( Fig. 1 , upper panel). The positive selectable marker cassette for co-transformation was used by an empty pBTEX binary vector ( Fig. 1 , lower panel). Competent Agrobacterium tumefaciens EHA105 was transformed with Glu-1Dy10 - cloned binary vector and an empty vector containing HPTII for the selectable marker using the freeze-thaw method [7] . T ₀ plants were selected on YEP media containing kanamycin (50 mg/l). Transformation was confirmed by PCR amplification of plasmids mini-prepped from each Agrobacterium strain [3] . Mature seeds of Oryza sativa L. subsp. japonica var. Dongjin were used to induce callus formation on callus induction (CI) medium [N6 salts [9] with vitamins, 2.5 g/l proline, 2 mg/l 2,4-D, 0.5 g/l casamino acid, 30 g/l sucrose and 2 g/l gelrite, pH 5.7]. After 21 days of incubation in the dark at 25°C, the scutellum-derived calli were excised and preincubated on CI medium for 1 week. Agrobacterial cells were grown on YEP solid medium containing antibiotics at 25°C for 2 days. And then, agrobacterial cells were resuspended in suspension medium (N ₆ salts with vitamins, 2 mg/l 2,4-D, 0.5 g/l casamino acid, 30 g/l sucrose, and 10 g/l glucose, pH 5.7) with 200 μM acetosyringone as a final concentration. After two Agrobacterium cells were mixed in a 3:1 ratio of EHA105 with Glu-1Dy10 gene expressing cassette and EHA105 with HPTII gene expressing cassette, the calli were transformed by swirling in the mixture of Agrobacterium cultures for 30 min. The calli were blotted on Whatman no. 1 paper and cocultivated on the cocultivation medium (N ₆ salts with vitamins, 2 mg/l 2,4-D, 0.5 g/l casamino acid, 30 g/l sucrose, 10 g/l glucose, and 2 g/l gelrite, pH 5.2 with 200 μM acetosyringone as a final concentration). After 3 days, the calli were washed with liquid CI medium supplemented with 250 mg/l cefotaxime and 150 mg/l and placed on the selection medium (CI medium supplemented with 50 mg/l hygromycin, 250 mg/l cefotaxime). After selection and regeneration, the regenerated plantlets were acclimatized and grown in a greenhouse. PCR was performed with the GeneAmp System 9700 (Applied Biosystems, Foster City, CA, USA) with a gene-specific primer set ( Glu-1Dy10 ; forward 5′-CGCAAGACAATATGAGCAAAC- 3′, reverse 5′-GTTGCCTTTGTCCTGTGTGCT- 3′, HPTII ; forward 5′-CGCTTCTGCGGGCGATTT-3′, reverse 5′-CCCATTCGGACCGCAAGGA -3′) and EF Taq DNA polymerase (Solgent Co. Seoul, South Korea). Each reaction mixture (30 μM) consisted of 10 mM Tris-HCl (pH 9.0), 1.5 mM MgCl ₂ , 40 mM KCl, 250 μM dNTPs, and 1 U Taq DNA polymerase. Amplified products were separated on a 1% agarose gel, stained with EtBr, and visualized with a UV illuminator. Rice genomic DNA was prepared by the CTAB extraction method [30] . Aliquots of 5 μg of purified DNA were digested with restriction endonuclease ( EcoRI ), size-fractionated on a 0.8% agarose gel, and the DNA was transferred to a nylon membrane through capillary blotting in 10× SSC (Gene Screen, DuPont, Wilmington, DE, USA). The blots were la-labeled using AlkPhos Direct (Amersham, GE Healthcare. Piscataway, NJ, USA) according to the manufacturer′s instructions. After hybridization, the filters were washed for 30 min at 55°C to remove unlabelled probe. Subsequently, CD-star Detection Reagent (Amersham, GE Healthcare. Piscataway, NJ, USA) was used to detect and generate signals. T ₁ generation seeds were frozen in liquid nitrogen and then ground to powder using a mortar and pestle. Total RNA was extracted using a method reported previously [33]. The isolated RNA preparations were then reverse-transcribed with oligo-dT primer and a First Strand cDNA Synthesis kit for RT-PCR (Roche Co., Basel, Switzerland) with gene-specific primers. The primers were as follows: Glu-1Dy10 forward 5′-CGCAAGACAATATGAGCAAAC- 3′, Glu-1Dy10 reverse 5′-GTTGCCTTTGTCCTGTGTGCT -3′; OsActin primers were used as internal standards for mRNA expression profiling [17 , 32] . The PCR conditions consisted of initial denaturation at 94°C for 4 min, followed by 30 cycles at 94°C for 1 min, 60°C for 1 min, 72°C for 2 min, and a final extension at 72°C for 10 min. The experiments were repeated three times and all produced similar results. The OsActin control primers were 5′- GGAACTGGTATGGTCAAGGC -3′ and 5′- AGTCTCATGGATACCCGCAG -3′ [8] . T ₁ generation seeds were frozen in liquid nitrogen and then ground to powder using a mortar and pestle. Total storage proteins in the rice endosperm were extracted with 50mM Tris-HCl (pH 8.0) containing 2% SDS, 50% of 1-propanol and 1% of dithiothreitol, as described [4] . Amount of extracted total proteins was measured by Nanodrop Spectrophotometer (ND-1000, Thermo Fischer Scientific, Wilmington DE, USA). Western blot analysis was performed as described [18] . Each EHA105 strain harboring Glu-1Dy10 expression vector or HPTII expression vector was cultured in YEP medium for plant transformation. The cultured cells were resuspended to OD600 =0.1 in AAM medium [11] , and each Glu-1Dy10 and HPTII cell was added at a 3:1 ratio. These mixed cells were co-infected into rice calli. The transformed calli were selected in hygromycin medium because we co-infected EHA 105 cells containing HPTII gene to calli. We obtained 290 independent hygromycin-resistant T ₀ plants through Agrobacterium -mediated co-transformation system. Genomic DNA from 290 independent T ₀ plants was extracted and insertion of HPTII and Glu-1Dy10 genes was analyzed using PCR analysis with gene specific primers. As shown in Figure 2 , HPTII gene in all of T ₀ plants was amplified, but no PCR products in ′Dongjin′ used as negative controls were detected. Next, we investigate the insertion of Glu-1Dy10 gene in T ₀ plants. Among 290 independent transgenic lines, only 29 T ₀ plants contained Glu-1Dy10 gene ( Fig. 2) . This result means that 29 transgenic lines harbored both Glu-1Dy10 and HPTII genes. And the co-transformation frequency was 10% in our experimental system ( Table 1 ). In a previous report, co-transformation frequency in rice was about from 2% to 14% [13] . This result indicates that transformation efficiency is dependent on rice cultivar and the experimental conditions. Although the generating of marker- free plants based on the Agrobacterium -mediated co-trans-formation using two different expression cassettes was need more time consuming and effort, this method could be efficiently produce marker-free transgenic rice plants. We performed Southern blot analysis to validate integration of Glu-1Dy10 genes and guess segregation ratio of the marker-free plant in T ₁ plants. One or multi signal bands were detected in 29 selected T ₀ plants lines ( Fig. 3 ). These results indicating that 29 selected transgenic lines were independent transgenic rice plants. We used HMW glutenin promoter to express Glu-1Dy10 because Glu-1Dy10 expression in rice endosperm is important for rice flour quality. Total RNAs from randomly selected two-copy inserted T ₁ transgenic seeds (13, 16, 29 lines) were extracted, and Glu-1Dy10 gene transcript level was examined by semi-quantitative RT-PCR. The Glu-1Dy10 transcripts were successively expressed in the T ₁ generation transgenic seeds, whereas Glu-1Dy10 expression in ′Dongjin′ was not detected ( Fig. 4 ). OsActin expression was used as a quantitative control. And we analyzed the protein expression of Glu-1Dy10 by Western blot with an anti x-type HMW specific antibody. The 11 transgenic plants (2, 6, 7, 9, 15, 18, 20, 22, 24, 26, 28) which were shown abnormal morphologies comparing with ′Dongjin′ were removed. After total proteins were extracted from wheat (′Jokyeong′ cultivar), ′Dongjin′ and transgenic plants, 0.5 μ g of wheat and 40 μ g of total protein extract of transgenic plants were used for SDS-PAGE. The immunospecificity of the anti- x-type HMW specific antibody was verified by in vivo experiment. Although the used antibody was x-type HMW specific, protein bands of Glu-1Dy10 were well detected in transgenic plants. However, the level of protein expression was not depended on their inserted copy number ( Fig. 5 ). No protein bands were detected in one copy-inserted lines and muti-copies inserted lines. We guess that the expression levels of Glu-1Dy10 were too low to detect signal in case of the one-copy inserted lines. In case of Multi-copies inserted lines, this phenomenon may be related to homology- dependent gene silencing in plants [2] . Genetic engineering of plants sometimes results in transgene silencing after integration into the genome, which may relate to a defense mechanism against foreign DNA expression [15 , 31] . Homology-dependent gene silencing has attracted considerable interest because it may be detrimental to genetic engineering and also because of its usefulness as a tool to study the mechanisms involved in detecting and inactivating exogenous DNA [15 , 16] . To select Glu-1Dy10 marker-free plants harboring only the Glu-1Dy10 gene, 72 T ₁ generation seeds of the transgenic plant 13 were planted in soil and genomic DNA was extracted from leaves of plantlets after 4 weeks. Insertion of the Glu-1Dy10 and HPTII genes was investigated by PCR analysis with Glu-1Dy10 and HPTII specific primers, respectively. As shown in Fig. 6 , most of the transgenic lines harbored both the Glu-1Dy10 and HPTII genes, and some inserted only the HPTII gene. However, transgenic 1, 7, 10, 14 and 21 lines contained only the Glu-1Dy10 gene ( Fig. 6 ). This result shows that marker-free plants containing only the Glu-1Dy10 gene were successfully screened at the T ₁ generation. Finally, we produced marker-free transgenic rice plants harboring Glu-1Dy10 gene. This marker-free transgenic plant harboring Glu-1Dy10 will become useful material to optimize transgenic rice plants, which has advanced quality processing of bread and noodle by crossing with genetically engineered rice plants with other gluten genes.