Advanced
Expression of Adenylyl Cyclase Genes in Mycobacterium smegmatis under Hypoxic and Nitric Oxide Conditions
Expression of Adenylyl Cyclase Genes in Mycobacterium smegmatis under Hypoxic and Nitric Oxide Conditions
Journal of Life Science. 2014. Dec, 24(12): 1330-1338
Copyright © 2014, Korean Society of Life Science
This is an Open-Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/3.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.
  • Received : October 16, 2014
  • Accepted : December 15, 2014
  • Published : December 30, 2014
Download
PDF
e-PUB
PubReader
PPT
Export by style
Share
Article
Author
Metrics
Cited by
TagCloud
About the Authors
한승 전
기훈 양
인정 고
정일 오
joh@pusan.ac.kr

Abstract
결핵균인 Mycobacterium tuberculosis H37Rv에서는 16개의 adenylyl cyclase (AC) 유전자가, 비병원성인 M. smegmatis 에서는 10개의 AC 유전자가 발견되었다. M. smegmatis 에서 발견된 10개의 AC 유전자들 중 MSMEG_0228, MSMEG_3243, MSMEG_3780, MSMEG_4279, MSMEG_4477, MSMEG_6154 유전자들의 발현은 저산소 조건에서 유도되었다. 반면에 M. smegmatis 가 nitric oxide (NO)에 노출이 되면 MSMEG_3780 MSMEG_4279 유전자의 발현이 유도되었다. 유산소 조건에서 키운 M. smegmatis 와 비교할 때, 저산소 조건에서 성장한 M. smegmatis 세포 내부와 성장 배지 내의 cAMP 양은 각각 450배와 9.8배 증가하였다. M. smegamtis 가 NO에 노출이 되면 세포 내의 cAMP 농도는 5.8배 증가하였다. DevSR two-component system은 M. smegmatis 가 저산소 조건이나 NO에 노출되었을 때 많은 유전자의 발현을 유도하는 주요 조절계로 알려져 있는데, 저산소 조건에서 발현이 유도된 6개의 AC 유전자의 발현이 M. smegmatis devR mutant에서도 wild type에서와 마찬가지로 저산소 조건에서 유도됨이 관찰되었다. 이 결과는 저산소 조건에서 발현이 유도되는 6개의 AC 유전자들이 DevSR two-component system에 의해 조절되지 않음을 나타내고 있다. 저산소 조건에서 발현이 가장 많이 유도된 MSMEG_3780 유전자의 발현조절에 관련이 있는 조절자를 발굴하기 위해 ligand fishing 분석을 수행하였고, 후보 조절자로서 MSMEG_5136을 발굴하였다.
Keywords
서 론
결핵균( Mycobacterium tuberculosis : Mtb)을 포함한 세균들이 변화되는 환경 내에서 효율적으로 생존하기 위해서는 외부의 환경을 인지하고 반응하여 변화된 환경에 효율적으로 적응을 해야 한다. 수용체(receptor)에 의한 외부 신호의 인지와 이와 수반된 신호전달경로(signal transduction pathway)를 통한 신호전달의 결과 유전자 발현의 조절, 효소 활성의 조절 및 세포 내부의 이온 농도의 변화에 의해 적응 반응(adaptive response)이 일어나게 된다. 많은 환경신호 분자(1차신호)들은 세포막을 자유롭게 통과하지 못하기 때문에 신호를 세포 내부의 신호전달 관련 단백질(kinase, transcription factor, ion channel 등)에 직접 전달해줄 수가 없다. 신호전달 경로에서 외부의 1차신호를 반영하여 세포 내부의 신호전달 관련 단백질의 활성을 조절하는 기능을 하는 작은 분자를 2차 전달자(secondary messenger)라 한다. 2차전달자의 기능을 하는 대표적인 분자는 3’,5’-cyclic adenosine monophosphate(cAMP)로 adenylyl cyclase (AC)에 의해서 ATP로부터 합성된다 [2 , 6 , 7 , 21] . AC는 촉매 도메인(catalytic domain)의 1차 구조를 바탕으로 최근까지 총 6개 class (class I to VI)로 분류가 되었고, 서로 다른 class에 속하는 AC 간에는 단백질 1차 구조의 유사성이 없다 [20 , 21] . Mycobacteria에서 지금까지 분석된 AC는 모두 class III로 분류되었고, class III AC 유전자가 Mycobacterium avium 에서 12개, Mycobacterium leprae 에서 4개, Mycobacterium marinum 에서 31개, Mycobacterium smegmatis 에서 9개, Mtb에서 16개가 밝혀졌다 [20 , 21] .
Class III AC는 고등식물을 제외한 원생생물, 균류(fungi), 조류(algae), 동물을 포함하는 진핵생물과 원핵생물에서 발견된다 [14 , 16] . 이 class에 속하는 AC들은 활성부위(active site)를 구성하는 cyclase domain (CD)의 아미노산 서열의 유사성을 갖는다. 대부분의 이 class의 AC는 CD 이외의 다른 도메인을 가지고 있는데 이 도메인들은 막에 AC를 위치시키거나, 수용체로서 신호인지, 그리고 하위 신호전달 요소로의 신호전달의 기능을 가지고 있다 [14 , 16] . 포유류에 존재하는 class III AC는 한 개의 polypeptide에 두 개의 CD를 포함하고 있고 CD의 intramolecular dimerization을 통해 한 개의 활성부위를 형성한다 [5 , 14 , 16] . 반면에 mycobacteria에서 발견되는 AC들은 하나의 polypeptide가 한 개의 CD만을 가져 활성부위를 형성하기 위해서는 homodimer의 4차구조를 가지며, 대부분의 AC가 서로 반대 방향으로(head to tail orientation) dimerization되어 두 개의 활성부위를 형성하게 된다 [9 , 20 , 21] . Class III에 속하는 AC의 활성부위에는 일반적으로 6개의 중요한 아미노산 잔기가 보존되어 있다 [14 , 15 , 16] . 촉매에 필요한 금속 이온(Mg 2+ 또는 Mn 2+ )이 결합하는 aspartate-aspartate 잔기쌍(Asp-231과 Asp-274 in Mtb Rv1625c), 기질인 ATP과 결합하여 기질특이성을 부여하는 잔기쌍(Lys-270과 Asp-339 in Mtb Rv1625c), 그리고 반응 중에 ATP의 ribose의 3’-hydroxyl group이 α-phosphate를 SN2 반응으로 공격해서 cAMP를 생성할 때 전이단계(transition state)의 분자를 안정화시키는 asparagine-arginine 잔기쌍(Asn-346과 Arg-350 in Mtb Rv1625c)이 보존되어 있는 6개의 아미노산 잔기에 해당한다. Class III AC의 활성에 필수적인 금속 이온은 ATP의 3개의 인산기와 결합하여 안정화시키며 ribose의 3’-hydroxyl group을 α-phosphate에 가까이에 위치시키는 것을 돕는다 [9 , 20] .
결핵균이 인체에 침입하여 폐에서 숙주 대식세포의 phagocytosis 작용에 의해 포식되면 대식세포의 phagosome에 머물며 증식하게 된다. 대식세포 내에서 결핵균이 생존하기 위해서는 phagosome과 lysosome의 융합(fusion) 현상을 억제해야 하고, 숙주의 적응면역(adaptive immunity)에 의해 활성화된 대식세포가 만들어 내는 reactive oxygen intermediate(ROI)와 NO와 같은 reactive nitrogen intermediate(RNI)를 방어할 수 있는 기작을 발현해야 하며, 대식세포 내의 저산소 조건에 적응하고, 단단한 염증조직인 육아종(granuloma)을 숙주의 감염 조직 부위에 형성하게 하여 다른 면역세포로부터 감염된 대식세포를 격리시켜야 한다. Mtb, Mycobacterium microti, Mycobacterium bovis, M. leprae 가 대식 세포 내로 들어가면 대식세포 내의 cAMP 농도가 크게 증가함이 보고되었고, cAMP 농도의 증가는 대식세포 내의 phagosomal actin의 조립(assembly)을 억제하여 phagosome과 lysosome의 융합을 억제한다고 보고되었다 [11 , 17 , 18] . 대식세포 내의 cAMP 농도의 증가는 protein kinase A (PKA)-cAMP response element binding protein (CREB) 신호전달 경로를 통해 tumor necrosis factor-α (TNF-α)의 합성을 증가시킨다고 보고되었다 [1] . 대식세포에 의한 TNF-α의 분비는 폐 조직에 caseous necrosis를 유발하고 투과성이 낮은 염증조직인 면역세포와 격리된 육아종의 형성을 유도하여 결핵균의 숙주내에서 생존율을 증가시킨다 [2] . 따라서 결핵균에 의한 면역세포 내에서의 cAMP의 증가는 결핵균의 숙주 내에서의 생존율을 증가시키게 된다.
본 연구에서는 외부 박테리아가 숙주에 감염되었을 때 숙 주 대식세포 내에서 유발되는 스트레스 중 저산소 조건과 NO 조건에서 M. smegmatis 내의 10개 AC유전자들의 발현을 mRNA 수준에서 관찰하였고, 동시에 세포 내에 합성되는 cAMP를 정량하였다. 또한 저산소 조건에서 발현이 유도되는 MSMEG_3780 AC 유전자의 발현을 조절하는 전사조절자의 후보단백질을 ligand-fishing과 mass spectrometry 방법을 이 용하여 발굴하였다.
재료 및 방법
- 사용된 균주, plasmid 그리고 배양 조건
본 연구에서 사용한 균주는 M. smegmatis mc 2 155와 이 균주로부터 유래된 돌연변이체인 M. smegmatis ΔdevR 이다( Table 1 ). 호기적 배양을 위해서는 M. smegmatis 는 37℃, 200rpm에서 0.2% (w/v) glucose와 0.02% (v/v) Tween-80이 첨가된 7H9 (Difco, Sparks, MD) 액체 배지에 배양하였다. 저산소 조건에서 M. smegmatis 를 배양하기 위해서는 150 ml 7H9배지를 넣은 250 ml 삼각플라스크에 OD 600 (optical density at 600 nm)이 0.05가 되도록 M. smegmatis 전배양액을 접종한 다음 고무마개로 플라스크를 밀봉하여 37℃, 200 rpm에서 20시간 동안 교반하며 배양하였다. NO 조건은 100 ml 7H9배지를 넣은 250 ml 삼각플라스크에 최종 부피의 1% (v/v)의 전배양액을 접종한 다음 37℃, 200 rpm에서 OD 600 이 0.5~0.6까지 도달할 때까지 배양한 후, 여기에 5 mM sodium nitropruside(SNP)를 처리한 후 백색광의 조사 조건에서 30분 더 배양하였다.
Bacterial strains and plasmids used in this study
PPT Slide
Lager Image
Abbriviations : Amp : ampicillin
- pMSMEG3780 plasmid 제조
M. smegmatis 의 chromosome DNA를 주형으로 MSMEG 3780-F (5’-ATTAGGTACCACTGCACGTGCTCG-3’)와 MSMEG3780-R (5’-TTAAGGGCCCGTGACGCAGGTTGTG-3’) primer를 사용하여 PCR를 수행하였다( pfu DNA polymerase 사용). 1803 bp의 PCR 산물을 KpnI과 ApaI으로 제한처리한 pT&A에 클로닝하여 pSMEG_3780을 제조하였다.
- M. smegmatis로부터 RNA 분리, reverse-transcription PCR (RT-PCR), real-time PCR (qRT-PCR)
M. smegmatis 균주에서 RNA의 분리, cDNA의 합성, RTPCR, qRT-PCR은 이전의 논문에 서술한 것과 같이 수행하였다 [12] . RT-PCR과 qRT-PCR에 사용한 primer들의 염기서열은 Table 2 에 나열하였다.
Primers used for RT-PCR and qRT-PCR
PPT Slide
Lager Image
Primers used for RT-PCR and qRT-PCR
- cAMP 농도 측정
1 ml의 M. smegmatis 배양액을 원심분리(13,400× g, 1분)하여 세균 균체(pellet)를 얻었고, 배지 내의 cAMP농도 측정을 위해서 배양액 상등액을 따로 분리하였다. 세포 내 cAMP 농도 측정을 위해 균주 pellet에 1 ml의 0.1 M HCl을 넣고 실온에서 완전히 현탁시킨 후, Fastprep 120 beadbeater를 이용하여 6.5의 속도에서 45초간 1회 세균 세포를 파쇄시켰다. 파쇄된 세포를 상온에서 13,400 ×g 속도로 10분간 원심분리하여 상등액을 얻었다. 배지 내의 cAMP 농도 측정은 따로 분리한 상등액 배지 900 μl에 100 μl의 HCl 원액을 넣고 상온에서 10분 동안 반응시킨 후 상온에서 13,400x g 속도로 10분간 원심분리 하여 상등액을 실험에 사용하였다. cAMP 농도는 Direct Cyclic AMP Enzyme Immunoassay Kit (Assay designs, Ann Arbor, MI)를 사용하여 측정하였고, Benchmark microplate reader (BIO-RAD, Hercules, CA) 장치를 이용하여 흡광도 405 nm에서 수치를 측정하였다.
- Ligand fishing 분석
Ligand fishing에 사용할 DNA 시료는 pMSMEG_3780 plasmid를 주형으로 이용하고 Taq DNA polymerase를 사용한 PCR을 수행하여 증폭하였다. MSMEG_3780 유전자의 시작 코돈으로부터 -400에서 +100까지 포함된 DNA 시료를 증폭하기 위해 MS3780pF(5’-TCTCGGCCTCGGTCAGGCCACCGCA-3’)와 5’ 말단에 biotin이 표식된 MS3780pR (GCGTCGTAGACAACGTTTGTTGTCA) primer를 PCR에 이용하였 다. 많은 양의 DNA 시료를 얻기 위해 50 μl의 20개 PCR 반응을 수행하여 총 1 ml의 PCR 산물을 얻었다. 증폭된 PCR 산물은 PCR purification kit (SolGent, 대전)를 이용하여 정제하였다.
M. smegmatis 균주를 MSMEG3780 유전자의 발현이 증가하는 저산소 조건에서 배양하고(4 l), 원심분리하여 세포를 얻었다. 이를 40 ml의 binding buffer (40 mM HEPES-KOH [pH7.9], 100 mM KCl, 10 mM MgCl2, 2 mM DTT, 10% glycerol)에 현탁시켜 French press를 5회 수행하여 세포를 파쇄하였다. 세포 파쇄액을 4℃에서 12,000x g 속도로 15분간 원심분리하여 세포 찌꺼기를 제거하고 상등액 부분인 세포추출액을 얻었다. 세포추출액을 다시 4℃에서 100,000× g로 90분간 초원심분리하여 soluble fraction에 해당하는 상등액 만을 얻었다. 1 ml의 streptavidin-agarose resin (Sigma, St. Louis, MO)과 준비된 DNA 시료를 실온에서 잘 흔들면서 30분간 반응시켜 증폭된 DNA 산물의 biotin과 streptavidin이 결합하도록 하였고 PCR 산물과 결합시킨 resin을 column에 충진하였다. 결합하지 않은 PCR 산물을 제거하기 위해 20 ml의 binding buffer로 resin을 씻은 후, 준비된 단백질 시료의 절반인 20 ml을 총 3회에 걸쳐 column에 천천히 통과시켜 DNA에 결합할 수 있는 단백질이 충분히 결합할 수 있도록 하였다. Resin에 결합하지 않은 단백질을 제거하기 위해 10 ml의 binding buffer로 씻어 준 후 3 ml의 elution buffer (0.5% SDS [sodium dodecyl sulfate])를 넣어 DNA에 결합된 단백질을 용출시켰다. DNA 시료가 아니라 streptavidin-agarose에 비특이적으로 결합할 수 있는 단백질을 배제시키기 위해 대조군으로 PCR 산물과 결합시키지 않은 streptavidin-agarose를 충진한 column을 이용하여 같은 실험을 반복하였다. 두 종류의 용출된 단백질 시료를 Centrifugal filters YM-10 (Millipore, Bedford, MA)을 이용해 농축시켰다. 농축시킨 단백질시료를 SDS-PAGE를 수행하여 분리하고 Coomassie blue R 350로 염색시켜 확인하였다. 대조군에는 없는데 실험군에서 나타난 단백질 밴드를 gel에서 잘라내어 MALDI-TOF(matrix-assisted laser desorption/ionization-time of flight) mass spectrometry를 수행하여 아미노산 서열을 분석함으로 써 단백질을 동정하였다.
- 단백질 농도 측정
Bovine serum albumin을 표준단백질로 사용하고, Bio-Rad protein assay kit (Bio-Rad, Hercules, CA)를 이용하여 단백질의 농도를 측정하였다.
결 과
- M. smegmatis의 AC 유전자 확인
National Center for Biotechnology Information (NCBI) database 검색을 통하여 비병원성인 M. smegmatis 에서 AC 관련 유전자들을 확인한 결과, MSMEG_0228, MSMEG_3243, MSMEG_3578, MSMEG_3780, MSMEG_4279, MSMEG_4477, MSMEG_4924, MSMEG_5018, MSMEG_6154 등 총 9개의 class III AC 유전자들을 확인하였다. 이 중 MSMEG_3243은 frameshift에 의해 유전자가 불활성화된 pseudogene으로 분석되었다. 또한 class III AC와 유사성은 없으나 AC로 분류된 단백질을 암호화하는 유전자( MSMEG_4302 )가 발굴되었는데 지금으로서는 이 유전자 산물이 AC 활성을 가졌는지는 알 수 없다. 총 10개의 AC 유전자들의 염기서열은 Comprehensive Microbial Resource(CMR) 사이트를 통해 확인 하였고, 각 AC의 도메인 구조는 Fig. 1 에 나타내었다.
PPT Slide
Lager Image
Domain compositions of class III ACs in M. smegmatis. The domain compositions were identified using the NCBI Conserved Domain Search (http://www.ncbi.nlm.nih.gov/Structure/cdd/wrpsb.cgi). Representative schematic domain compositions are shown where the vertical lines represent the predicted transmembrane helices and other abbreviations are as follows: αβH, αβ-hydrolase; ATPase, AAA+type ATPase; Cyc, class III cyclase domain; H, HAMP domain; CYTH, CyaB-thiamine triphosphatase domain; CHAD, conserved histidine α-helical domain.
- 저산소 조건과 NO 조건에서의M. smegmatis내의 cAMP 농도
저산소 조건(hypoxic condition)에서 성장했을 경우 M. smegmatis 의 세포 내․외에서 합성되는 cAMP양을 측정하였다. 저산소 조건에서 배양한 세포 내에서 합성된 cAMP 농도는 유산소 조건에서 보다 약 400배 이상 증가하였고 배지로 분비된 cAMP 농도 또한 저산소 조건에서 유산소 조건일 때보다 약 10배 정도 더 증가하였다( Fig. 2 ).
NO를 처리한 M. smegmatis 내에서는 대조군과 비교하여 cAMP 농도가 약 7~8배 증가하였다( Fig. 2 ). 이 결과는 M. smegmatis 가 숙주 대식세포 내에서 겪을 수 있는 저산소와 NO 스트레스에 노출되게 되면 세포 내 cAMP 농도가 크게 증가함을 나타내고 있다.
PPT Slide
Lager Image
Determination of cAMP concentration inside M. smegmatis cells and in culture medium. To measure cAMP levels, M. smegmatis strains were grown under aerobic, NO, or hypoxic conditions. The Direct Cyclic AMP Enzyme Immunoassay Kit was used to measure the cAMP concentration. Error bars indicate standard deviations.
- 저산소 조건에서의 AC유전자 발현.
저산소 조건에서 M. smegmatis 의 10개 AC유전자 발현 정도를 관찰하기 위해, RT-PCR을 이용하여 확인하였고( Fig. 3A ), qRT-PCR을 통해 이를 재확인하고 정량화를 하였다( Fig. 3B ). 저산소 조건에서 유전자 발현이 증가된다고 이미 알려진 hspX 유전자를 양성대조군(positive control)으로 RT-PCR( Fig. 3A )과 qRT-PCR ( Fig. 3B )에서 사용하였고, 16S rRNA를 이용하여 결과 값을 보정하였다. M. smegmatis 의 총 10개 AC 가운데 6개의 AC 유전자( MSMEG_0228, MSMEG_3243, MSMEG_3780, MSMEG_4279, MSMEG_4477, MSMEG_6154 )가 유산소 조건과 비교할 때 저산소 조건에서 발현이 증가되는 것을 확인할 수 있었다. 특히 MSMEG_0228, MSMEG_3243 유전자는 유산소 조건에서 키운 균주에서 보다 저산소 조건에서 키운 균주에서 발현이 2~3배 증가하였고, MSMEG_3780 MSMEG_4279 의 발현은 저산소 조건에서 4~5배 증가하였다. 반면에 MSMEG_3578과 MSMEG_4924의 발현은 저산소 조건에서 오히려 감소하였다. 이 결과는 M. smegmatis 가 저산소 스트레스 환경에 있게 되면 10개의 AC유전자 중 6개의 AC유전자의 발현이 증가함을 나타내고 있다.
PPT Slide
Lager Image
Expression of AC genes in M. smegmatis under aerobic and hypoxic conditions. Expression of the AC genes was determined by RT-PCR (A) and qRT-PCR (B). For hypoxic culture, M. smegmatis strains were grown in 250 ml flasks filled with 150 ml of 7H9 medium supplemented with 0.2% glucose and tightly sealed with rubber stoppers on a gyratory shaker (200 rpm) for 20 h following inoculation of the medium with aerobically grown preculture to an OD600 of 0.05. For aerobic culture, M. smegmatis strains were grown aerobically in 7H9-glucose medium to an OD600 of 0.5~0.6. hspX, whose expression is known to be increased under hypoxic conditions, was used as a positive control for RT-PCR. The relative levels of mRNA were determined from the threshold values that were normalized to 16S rRNA gene expression. The valule of the wild type grown under aerobic conditions is expressed as 1.0 (dotted line), and the relative levels of AC mRNA are plotted.
- 저산소 조건에서 AC 유전자의 발현 유도와 DevSR two-componenet system과의 관련
저산소 조건에서 발현이 유도된 6개의 AC 유전자들이 M. smegmatis 에서 산소 분압을 인지하여 저산소 조건에서 유전자 발현을 유도하는 조절계인 DevSR two-component system에 의해 발현이 유도되는지 알아보기 위하여, 유산소 조건과 저산소 조건에서 키운 DevR response regulator 유전자가 결손된 M. smegmatis mutant 에서 AC 유전자 발현을 RT-PCR을 통해 비교하였다( Fig. 4 ). 이 실험에서는 DevR에 의해 발현이 유도된다고 알려진 hspX 유전자를 대조군으로 사용하였고, 16S rRNA의 정량을 통해 RT-PCR에 동일한 양의 total RNA가 사용되었는지 확인하였다. Fig. 4 에서 나타내었듯이 wild type에서 저산소 조건에서 발현이 유도된 6개의 AC 유전자 ( MSMEG_0228, MSMEG_3243, MSMEG_3780, MSMEG_4279, MSMEG_4477, MSMEG_6154 )의 발현이 M. smegmatis Δ devR mutant에서도 저산소 조건에서 유도되는 것을 관찰하였다. 예상한 것과 부합되게 DevR regulon에 속하는 hspX 유전자의 발현은 저산소 조건에서 배양한 mutant에서 유도되지 않았다. 이 결과는 저산소 조건에서 6개의 AC 유전자 발현이 DevSR two-componenet system에 의해 유도되는 것이 아니고, 다른 조절계에 의한 것임을 나타내고 있다.
PPT Slide
Lager Image
The hypoxic induction of AC genes in M. smegmatis is independent of the DevSR two-component system. To investigate whether the DevSR two-component system is involved in the induction of 6 AC genes induced under hypoxic conditions, expression of the AC genes in the ΔdevR mutant of M. smegmatis was determined by RT-PCR. The ΔdevR mutant strain of M. smegmatis was grown either aerobic or hypoxic conditions. hspX, whose expression is known to be increased under hypoxic conditions, was used as a positive control for RTPCR.
- NO조건에서의 AC유전자의 발현
NO 비처리 조건과 NO 처리 조건에서의 M. smegmatis 내 10개 AC 유전자 발현 양상을 비교하기 위해, RT-PCR을 수행하였고( Fig. 5A ), qRT PCR을 통해 발현량을 측정하였다( Fig. 5B ). NO 조건은 지수성장기(OD 600 =0.5~0.6)까지 배양한 M. smegmatis 에 NO 발생 물질인 SNP를 최종 농도 5 mM을 넣은 후 빛이 있는 상태(SNP는 빛에 의해 분해되어 NO를 발생시킨다)에서 30분 동안 더 배양하였다. NO 발생 확인을 위해, NO 조건에서 DevSR two-component system에 의하여 발현 이 증가된다고 알려진 hspX 유전자를 양성대조군으로 실험에 사용하였다. 예상한데로 NO 처리 시에 hspX 의 발현은 비처리 대조군에 비하여 5.3배 증가하였다. NO 처리에 의해서 M. smegamtis 의 10개 AC 유전자 중 MSMEG_3780 MSMEG_4279 유전자의 발현이 각각 1.4배, 1.5배 증가하였고, MSMEG_3578, MSMEG_4477, MSMEG_6154 유전자의 발현은 오히려 감소하였다.
PPT Slide
Lager Image
Expression of AC genes in M. smegmatis exposed to NO. Expression of the AC genes was determined by RT-PCR (A) and qRTPCR (B). Following M. smegmatis strain was grown in 7H9-glucose medium to an OD600 of 0.5 to 0.6, SNP (NO generator) was added to the culture at the final concentrations of 5 mM and the culture was grown for additional 30 min under the illumination of light (+NO). Control: M. smegmatis strain was grown aerobically in 7H9-glucose medium to an OD600 of 0.5 to 0.6 (-NO). hspX, whose expression is known to be increased under hypoxic conditions, was used as a positive control for RT-PCR. The relative levels of mRNA were determined from the threshold values that were normalized to 16S rRNA gene expression. The value of the wild type grown under aerobic conditions is expressed as 1.0 (dotted line), and the relative levels of AC mRNA are plotted.
- 저산소 조건에서MSMEG_3780유전자의 발현을 유도하는 전사조절자의 탐색
AC 유전자 중 유산소 조건과 비교하였을 때 저산소 조건에서 가장 발현이 많이(5.7배) 유도된 MSMEG_3780 유전자의 발현을 조절하는 전사조절자를 발굴하기 위한 접근 방법으로 ligand fishing 실험 기법을 적용하였다. MSMEG_3780 의 5’ 유전자 부위 100 bp와 유전자 앞부분 400 bp로 이루어진 500bp DNA 단편을 PCR을 이용하여 증폭하였다. PCR에 사용된 두 개의 primer 중 하나는 5’ 말단이 biotin으로 표식된 것을 사용하여 증폭된 PCR 산물의 한쪽 끝은 biotin에 의해 표식되도록 하였다. 획득한 PCR 산물과 streptavidin agarose resin을 이용하여 affinity chromatography를 수행하였고, 이 방법으로 저산소 조건에서 배양한 M. smegmatis 의 세포 내의 단백질 중 PCR 산물에 결합 능력을 가지는 단백질을 분리하였다. Fig. 6 에서 나타낸 것과 같이, MSMEG_3780 조절부위를 포함하는 500-bp DNA 단편을 붙인 agarose resin에서 용출된 단백질들(lane 1)과 대조군으로 사용한 DNA 단편을 붙이지 않은 agarose resin에서 용출된 단백질들(lane 2)을 비교하였을 때, 500 bp DNA 단편을 붙인 agarose resin에서만 용출된 단백질 중 가장 뚜렷한 것이 약 17 kDa의 크기를 가진 단백질이었다. Gel에서 분리한 17 kDa 단백질을 MALDI-TOF를 이용하여 분석한 결과 MSMEG_5136 단백질로 동정되었다. 이 결과는 MSMEG_5136 단백질이 MSMEG_3780 의 조절 부위에 결합할 수 있는 능력이 있음을 암시하고 있다. MSMEG_5136은 150개의 아미노산으로 구성되어 있으며 이론적 분자량은 16.6 kDa으로 계산되었다. 계산된 분자량은 ligand fishing에서 분리된 단백질의 분자량과 잘 일치하였다. NCBI (National Center for Biotechnology Information) web site의 BLASTP를 이용하여 MSMEG_5136와 아미노산 서열에서 유사성이 높은 단백질을 검색한 결과 MSMEG_5136은 Mycobacterium sp. MCS의 Mmcs_3622 (YP640785) 단백질과 아미노산 서열 수준에서 75% 동일하였고, Thermomonospora curvata 의 pyridoxamine 5’-phosphate oxidase-related FMN-binding protein (YP003298133)과 50% 동일하였다. 또한 MSMEG_5136 단백질은 DNA 결합 부위로서 역할을 하는 helix-turnhelix motif를 가지고 있는 것으로 예상되었다.
PPT Slide
Lager Image
SDS-PAGE of proteins that bound to the MSMEG_3780 control region. Proteins were eluted from streptavidin- agarose resin with 0.1% (w/v) SDS solution. Lane 1, proteins eluted from streptavidin-agarose resin linked with the MSMEG_3780 control region. Lane 2, proteins eluted from streptavidin-agarose resin without the MSMEG_3780 control region. The amino acid sequence of the boxed 17-kDa protein was identified by MALDITOF to be the MSMEG_5136 protein containing a helix-turn-helix DNA-binding motif.
고 찰
대식세포 내의 cAMP 농도가 높아지면 phagosome-lysosome 융합 과정이 억제되어 대식세포 내의 결핵균의 생존율이 증가하게 된다 [11 , 18] . 살아있는 M. tuberculosis, M. bovis, M. microti , 그리고 M. leprae 가 대식세포에 감염되면 대식세포 내의 cAMP 농도가 증가됨이 보고되었고 [17 , 18] , M. tuberculosis 의 Rv0386 AC는 대식세포 내에서 cAMP 농도를 증가시키는 AC로 보고가 되었다 [1] . 하지만 대식세포 내의 어떤 조건 혹은 신호가 mycobacteria의 cAMP 생산 능력을 증가시키는가에 대한 체계적인 연구가 지금까지 보고된 적이 없다. 대식세포의 phagosome 내의 환경은 산소 분압이 세포 바깥보다 낮은 저산소 조건, 탄소원(에너지원)과 무기인산과 같은 영양분이 부족한 조건, 낮은 pH 조건 그리고 면역학적으로 활성화된 대식세포 내에서는 NO와 ROI가 생성되어 세균의 생존에 매우 불리한 조건이다 [19] . 최근 영양분 결핍 조건, 낮은 pH 조건과 H 2 O 2 처리 조건에서 M. smegmatis 내의 AC 유전자들의 발현 양상을 조사한 내용이 보고되었는데 [8] , MSMEG_4279 유전자는 영양분 결핍 조건에서 발현이 증가하였고, MSMEG_4924 유전자는 H 2 O 2 처리 조건에서 발현이 감소하였다. 그리고 MSMEG_3780 유전자는 낮은 pH와 영양분 결핍 조건에서 발현이 감소하였다. 본 연구에서는 대식세포 내의 스트레스 조건 중 저산소 조건과 NO 조건을 실험실 조건에서 M. smegmatis 에 직접 노출시켰을 때 이 세균 내의 cAMP 농도와 cAMP를 합성하는 AC 유전자들의 발현 양상을 조사하였다. 저산소 조건 스트레스에 노출된 M. smegmatis 내의 cAMP 농도는 약 400배, 그리고 배지 내에 분비된 cAMP 양은 약 10배 정도 유산소 조건에서 배양한 M. smegmatis 보다 증가함을 관찰할 수 있었다. 저산소 조건에서 키운 M. smegmatis 배지 내의 cAMP 농도는 0.5 μM에 이를 정도로 고농도였는데, 이는 mycobacteria가 세포 내에서 합성한 cAMP를 활발히 분비할 수 있음을 나타내고 있다. NO를 처리한 조건에서 M. smegmatis 내의 cAMP 농도는 비처리군에 비해 7-8배 증가하였고, 마찬가지로 10 mM H 2 O 2 를 처리 시에는 세포내의 cAMP 농도가 약 5-6배 증가하였다(data not shown). 이 결과는 산화적 스트레스나 NO 스트레스 조건에서 M. smegmatis 내의 cAMP 농도가 증가는 하지만 저산소 조건 스트레스가 cAMP 농도의 증가에 훨씬 중요한 환경 요인임을 암시하고 있다. M. smegmatis 를 초기 정체기(OD 600 =2.6-2.7)까지 성장시키면 세포 내의 cAMP의 농도가 약 95배 증가함을 관찰할 수 있었는데(data not shown), 이는 정체기의 배지 내의 산소 분압의 감소와 영양분 고갈에 의한 것으로 예측된다. 세포 내의 cAMP 농도는 AC 유전자의 발현 유도에 의한 AC 효소량의 증가, AC 활성의 조절, cAMP phosphodiesterase에 의한 cAMP의 AMP로의 분해, cAMP의 세포 바깥으로 분비에 의해 조절된다 [3] . 저산소 조건에서 6개의 AC 유전자 ( MSMEG_0228, MSMEG_3243, MSMEG_3780, MSMEG_4279, MSMEG_4477, MSMEG_6154 )가 M. smegmatis 에서 발현이 유도되는데, 이 중 MSMEG_0228, MSMEG_3243, MSMEG_3780 MSMEG_4279 의 발현이 가장 크게 유도되었다. 저산소 조건에서의 AC들의 활성이 단백질 수준에서 조절되어 증가하는지는 알 수 없지만, 위의 6개의 AC들은 저산소 조건에서 M. smegmatis 내의 cAMP 농도 증가에 기여를 할 것으로 예측된다. NO 처리 조건에서 M. smegmatis 세포 내의 cAMP 수준은 7-8배 증가하였으나 발현량이 크게 (>2배) 증가한 AC 유전자는 없었다. 이 결과는 nitrosative 스트레스 조건에서 세포 내 cAMP의 농도 증가는 AC 유전자의 발현 조절이 아닌 AC의 활성 조절에 의해 주로 이루어 짐을 암시하고 있다.
M. smegmatis 에서 저산소 조건과 NO 조건에서 유전자의 발현을 유도하는데 있어서 가장 중요한 역할을 하는 조절계는 DevSR (DosSR) two-component system이다 [12 , 13] . DevSR two-component system은 DevS histidine kinase와 DevR response regulator로 이루어져 있는데, DevS histidine kinase는 신호인지 도메인에 b -type heme을 가지고 있어서 산소 분자와 NO, CO와 같은 이원자 분자와 결합할 수 있다. Heme에 산소가 결합거나 heme 안의 철이온이 Fe 3+ 상태로 존재하게 되면 DevS의 kinase 활성이 억제가 되고, 반면에 heme에 어떤 분자도 결합되지 않은 상태(unliganded Fe 2+ 상태)이거나 NO가 heme에 결합하면 DevS kinase 활성이 증가 하게 된다. 따라서 DevS는 저산소 조건 혹은 NO 조건에서 kinase 활성이 증가하고, 따라서 DevR response regulator가 인산화되어 활성화되면 DevR regulon의 발현이 유도되게 된다. 저산소 조건에서 발현이 유도된 AC들의 발현이 Δ devR mutant에서도 wild type에서와 마찬가지로 저산소 조건에서 유도된다는 사실은 6개의 AC 유전자의 발현이 DevSR two-component system에 의해 조절되지 않음을 나타낸다. 이것은 이 6개의 AC 유전자가 NO 조건에서 발현이 크게 유 도되지 않는 사실로도 증명된다.
10개의 AC 유전자 중 저산소 조건에서 가장 발현이 많이 유도된 MSMEG_3780 유전자의 발현 조절에 관련이 있는 전사조절자를 찾기 위하여 ligand fishing 분석을 하였고, MSMEG_3780 유전자의 상위 부위(upstream region)에 MSMEG_5136 단백질이 결합함을 발견하였다. 단백질 2차구조 분석 결과 MSMEG_5136은 helix-turn-helix DNA-binding motif를 가지고 있었고 아미노산 서열 수준에서 pyridoxamine 5’-phosphate oxidase-related FMN-binding protein과 유사성을 보였는데, 이것은 MSMEG_5136 단백질이 FMN을 cofactor로 가지고 있는 DNA 결합 단백질일 가능성을 암시하고 있다. FMN은 전자를 한 개 혹은 2개를 주고 받을 수 있는 분자로 세포 내의 redox 환경을 인지할 수 있다. 저산소 조건에서는 호흡 전자전달계가 억제되어 세포 내의 환경이 보다 환원된 상태로 바뀌게 된다. 따라서 MSMEG_5136은 저산소 조건에서 세균 내의 redox 상태의 변화를 인지하는 전사조절자로 역할을 할 가능성이 있다. MSMEG_5136이 MSMEG_3780 AC 유전자의 발현 조절에 관련이 있는가에 대한 확실한 증거는 MSMEG_5136 mutant의 구축이 필요하고 해당 연구는 현재 진행 중이다.
Acknowledgements
이 논문은 부산대학교 자유과제 학술연구비(2년)에 의해 연구되었음.
References
Agarwal N. , .Lamichhane G. , Gupta R. , Nolan S. , Bishai W. R. 2009 Cyclic AMP intoxication of macrophages by a Mycobacterium tuberculosis adenylate cyclase Nature 460 98 - 102    DOI : 10.1038/nature08123
Antoni F. A. 2000 Molecular diversity of cyclic AMP signalling Front Neuroendocrinol 21 103 - 132    DOI : 10.1006/frne.1999.0193
Bai G. , Knapp G. S. , McDonough K. A. 2011 Cyclic AMP signaling in mycobacteria: redirecting the conversation with a common currency Cell Microbiol 13 349 - 358    DOI : 10.1111/j.1462-5822.2010.01562.x
Baillie L. , Read T. D. 2001 Bacillus anthracis, a bug with attitude! Curr Opin Microbiol 4 78 - 81    DOI : 10.1016/S1369-5274(00)00168-5
Baker D.A. , Kelly J. M. 2004 Structure, function and evolution of microbial adenylyl and guanylyl cyclases Mol Microbiol 52 1229 - 1242    DOI : 10.1111/j.1365-2958.2004.04067.x
Botsford J. L. , Harman J. G. 1992 Cyclic AMP in prokaryotes Microbiol Rev 56 100 - 122
Buck J. , Sinclair M. L. , Schapal L. , Cann M. J. , Levin L. R. 1999 Cytosolic adenylyl cyclase defines unique signaling molecule in mammals Proc Natl Acad Sci USA 96 79 - 84    DOI : 10.1073/pnas.96.1.79
Casey S. J. , Ford M. J. , Gazdik M. A. 2014 The role of transcriptional regulation in maintaining the availability of mycobacterial adenylate cyclases Peer J 2 e298 -    DOI : 10.7717/peerj.298
Jeon H. S. , Ko I. J. , Oh J. I. 2011 Adenylyl cyclases in mycobacteria J Life Sci 21 473 - 479    DOI : 10.5352/JLS.2011.21.3.473
Jessee J. 1986 New subcloning efficiency competent cells: > 1 × 106 transformants/g Focus 8 9 -
Kalamidas S. A. , Kuehnel M. P. , Peyron P. , Rybin V. , Rauch S. , Kotoulas O. B. , Houslay M. , Hemmings B. A. , Gutierrez M. , Anes E. , Griffiths G. 2006 cAMP synthesis and degradation by phagosomes regulate actin assembly and fusion events: consequences for mycobacteria J Cell Sci 119 3686 - 3694    DOI : 10.1242/jcs.03091
Kim M. J. , Park K. J. , Ko I. J. , Kim Y. M. , Oh J. I. 2010 Different roles of DosS and DosT in the hypoxic adaptation of mycobacteria J Bacteriol 192 4868 - 4875    DOI : 10.1128/JB.00550-10
Lee J. M. , Cho H. Y. , Cho H. J. , Ko I. J. , Park S. W. , Baik H. S. , Oh J. H. , Eom C. Y. , Kim Y. M. , Kang B. S. , Oh J. I. 2008 O2- and NO-sensing mechanism through the DevSR two-component system in Mycobacterium smegmatis J Bacteriol http://dx.doi.org/10.1128/JB.00401-08 190 6795 - 6804    DOI : 10.1128/JB.00401-08
Linder J. U. , Schultz J. E. 2003 The class III adenylyl cyclases: multi-purpose signalling modules Cell Signal 15 1081 - 1089    DOI : 10.1016/S0898-6568(03)00130-X
Linder J. U. 2005 Substrate selection by class III adenylyl cyclases and guanylyl cyclases IUBMB Life 57 797 - 803    DOI : 10.1080/15216540500415636
Linder J. U. 2006 Class III adenylyl cyclases: molecular mechanisms of catalysis and regulation Cell Mol Life Sci 63 1736 - 1751    DOI : 10.1007/s00018-006-6072-0
Lowrie D. B. , Jackett P. S. , Ratcliffe N. A. 1975 Mycobacterium microti may protect itself from intracellular destruction by releasing cyclic AMP into phagosomes Nature 254 600 - 602    DOI : 10.1038/254600a0
Lowrie D. B. , Aber V. R. , Jackett P. S. 1979 Phagosome-lysosome fusion and cyclic adenosine 3':5'-monophosphate in macrophages infected with Mycobacterium microti, Mycobacterium bovis BCG or Mycobacterium lepraemurium J Gen Microbiol 110 431 - 441    DOI : 10.1099/00221287-110-2-431
Schnappinger D. , Ehrt S. , Voskuil M. I. , Liu Y. , Mangan J. A. , Monahan I. M. , Dolganov G. , Efron B. , Butcher P. D. , Nathan C. , Schoolik G. K. 2003 Transcriptional adaptation of Mycobacterium tuberculosis within macrophages: insights into the phagosomal environment J Exp Med 198 693 - 704    DOI : 10.1084/jem.20030846
Shenoy A. R. , Visweswariah S. S. 2006 Mycobacterial adenylyl cyclases: biochemical diversity and structural plasticity FEBS Lett 580 3344 - 3352    DOI : 10.1016/j.febslet.2006.05.034
Shenoy A. R. , Visweswariah S. S. 2006 New messages from old messengers: cAMP and mycobacteria Trends Microbiol 14 543 - 550    DOI : 10.1016/j.tim.2006.10.005
Snapper S. B. , Melton R. E. , Mustafa S. , Kieser T. , Jacobs W. R. 1990 Isolation and characterization of efficient plasmid transformation mutants of Mycobacterium smegmatis Mol Microrbiol 4 1911 - 1919    DOI : 10.1111/j.1365-2958.1990.tb02040.x