Advanced
Dormancy Associated Weedy Risk of the F1 Hybrid Resulted from Gene Flow from Oilseed Rape to Mustard
Dormancy Associated Weedy Risk of the F1 Hybrid Resulted from Gene Flow from Oilseed Rape to Mustard
Weed & Turfgrass Science. 2015. Mar, 4(1): 35-43
Copyright © 2015, The Korean Society of Weed Science and The Turfgrass Society of Korea
This is an Open-Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/3.0) which permits unrestricted noncommercial use, distribution, and reproduction in any medium, provided the original work is properly cited.
  • Received : December 01, 2015
  • Accepted : March 11, 2015
  • Published : March 31, 2015
Download
PDF
e-PUB
PubReader
PPT
Export by style
Share
Article
Author
Metrics
Cited by
About the Authors
Yeonhwa Lim
Min-Jung Yook
Chuan-Jie Zhang
Gyoungju Nah
Suhyoung Park
Do-Soon Kim
dosoonkim@snu.ac.kr

Abstract
본 연구는 유채의 화분이동으로 근연종 갓과의 교잡을 통해 형성된 교잡종의 발아휴면특성과 월하 및 월동성을 평가하여 교잡종의 잡초화 가능성을 예측하고자 본 연구를 수행하였다. 교잡종은 부본인 유채와 모본인 갓에 비해 전반적인 발아특성이 갓에 근접한 중간적인 특성을 보여주었으며, 휴면성도 41.1%로 갓에 근접한 높은 휴면성을 보여주었다. 수확 직후 종자를 토양에 매립하여 월하특성을 평가한 결과 표토보다는 3 cm 토심에서 월등히 높은 월하특성을 보여주었으며, 월하기간과 상관없이 3 cm 토심조건에서 부본인 유채에 비해 매우 높고 모본인 갓에 비해 약간 높은 월하특성을 보여주었다. 반면 종자의 월동특성은 월하특성과 반대로 표토조건에서 교잡종이 부모종보다 높은 월동성을 가지는 것으로 확인되었다. 따라서 유채-갓 교잡종은 휴면성이 비교적 높고 월하 및 월동성이 높아 잡초화 가능성이 있음을 시사한다. 유채-갓 교잡종의 보다 명확한 잡초화 가능성 평가를 위해서는 교잡종의 종자생산 가능성 및 자연 생태계 적응성 여부에 대한 추가적인 연구가 필요하다.
Keywords
서 론
유채는 세계 주요 유전자변형 작물 중 하나이며, 충매와 풍매에 의해 수분 및 교잡이 원활히 발생하기 때문에 재배종 및 근연종으로의 유전자 이동 위험이 높다 (Kim et al., 2012) . 갓( Brassica juncea )은 유채와 동속(同屬) 식물로서 프랑스 (Liu et al., 2010) , 중국 (Di et al., 2009) , 캐나다 (Bing et al., 1996) , 덴마크 (Jorgensen et al., 1994) 에서 교잡이 발생함을 보고한 바 있으며, 일본과 한국에서는 각각 17.5 m, 16 m의 먼 거리에서도 유채와 갓이 각각 0.0344%, 0.007%로 교잡되었음을 보고하였다 (Tsuda et al., 2012 ; National Institute of Environmental Research, 2013) . 국내에서는 다양한 갓 품종이 일반농가에서 식용 목적으로 재배되고 있으며, 야생갓( Sinapsis arvensis ) 역시 한반도 남부지역에서 잡초로 흔히 발견된다. 한국은 농지 단위가 작고, 좁은 지역에 다양한 근연종 배추과(Brassicaceae) 작물을 재배한다는 점에서 유채의 화분을 통한 유전자 이동 및 근연종과 교잡에 의한 교잡종의 발생 가능성이 더 높을 것으로 예상된다. 국내에서는 유전자변형 작물이 아직 재배되고 있지는 않지만 2013년에는 식용, 가공용 및 사료용으로 약 887.7만 톤의 유전자변형 곡물이 수입되었다 (Korea Biosafety Clearing House, 2014) . 이에 따라 이들 유전자변형 곡물이 이송 등의 과정에서 비의도적으로 방출되어 자연생태계에서 서식하고 있는 사례가 확인되기도 하였다. 2012년 국립환경과 학원의 보고에 따르면 2009년에서 2012년까지 전국 47개 지역에서 유전자변형 옥수수, 유채, 면화 등이 확인되었다 (National Institute of Environmental Research, 2012) . 따라서 비의도적으로 방출된 유전자변형 유채로부터 유전자 이동에 따른 교잡종의 형성 및 잡초화 가능성도 우려되고 있다.
유전자변형 유채의 유전자 이동으로 인해 1세대 교잡종이 발생했다는 사실만으로는 환경위해성에 관한 결론을 도출할 수 없는데 (Andersson and Vicente, 2010) , 이는 세대 진전과정에서 선택압력(selection pressure)에 의해 장기적으로 자연 도태될 수도 있기 때문이다 (Snow et al., 2005 ; Kwon et al., 2001a) . F1교잡종이 생장 및 세대진전 과정에서 받게 되는 첫 번째 선택압력이 종자의 휴면능력이다. 유채와 갓의 종자는 보통 초여름에 등숙하여 수확하며 이때 주로 종자의 탈립이 발생하는데, 특히 유채는 온도가 높고 바람이 많이 불 때 최대 70%까지 탈립이 발생하는 것으로 알려져 있다 (Colton and Sykes, 1992) . 이들 탈립종자가 자연상태에서 다음주기의 생육 및 종자생산을 하기 위해서는 활력있는 종자형태로 토양중에 월하(越夏)하는 것이 필수적이며, 보다 장기적으로는 월동능력 역시 중요하다. 해외에서는 Gulden et al. (2004a , 2004b) , Simard et al. (2002) , Pekrun et al. (1997) 등이 토중 매립 깊이에 따른 유채 종자의 휴면성에 관해 보고하였으나, 국내환경에서 계절과 토심에 따른 유채-갓 교잡종의 휴면성 변화에 대한 연구는 아직 부족한 실정이다.
따라서 본 연구는 자연수분을 통해 유채( Brassica napus )로부터 갓( Brassica juncea )으로 유전자 이동이 발생한 교잡개체의 발아, 월동 및 월하 휴면특성을 확인하여 추후 유전자변형 유채의 장기적인 잡초화 및 생태계 교란 가능성을 연구하기 위한 기초 정보를 확보할 목적으로 수행되었다.
재료 및 방법
- 공시재료
유채( Brassica napus cv. Tammi)를 부본으로 웅성불임 갓( Brassica juncea )을 모본으로 교배하여 확보된 교잡 제1세대 종자를 본 실험에 사용하였다. 유채 종자는 국립식량과 학원에서, 웅성불임 갓은 국립원예특작과학원에서 분양 받았다. 유채와 웅성불임 갓간의 교배는 2012년 8월부터 10월까지 수원시 소재 서울대학교 실험농장의 LMO격리포장에서 수행되었으며, 11월에 결실종자를 수확한 후 4℃ 항온 종자저장고에 보관하였다. 모본인 웅성불임 갓에서 수 확된 교잡종자의 유채와의 실제 교잡 여부를 확인하고 이를 보정계수로 사용하기 위해 분자마커검정을 실시하였다. 교잡종자 105립을 파종하여 2엽기에 잎에서 전체 DNA를 추출하고, 배추과를 구분하는 SSR마커로 보고된 BoKAH45TR( Table 1 )를 이용하여 PCR검정을 진행하였다 (Louarn et al., 2007) . 그 결과 101개체에서 유채 특이적 서열의 존재가 확인되었으며, 이를 바탕으로 수확된 종자의 96.2%는 유전자 이동으로, 3.8%는 임성 회복으로 인해 발생했음을 추론하여 0.962를 보정계수로 사용하였다( Fig. 1 ). 따라서 발아율, 휴면율 등 모든 지표는 각각의 평가대상 식물종의 평가 종자수를 기준으로 1차적으로 계산한 후 그 값에 보정계수 0.962를 곱하여 계산 하였다.
SSR markers used to amplify unique DNA regions in the oilseed rape and to identify if F1 hybrid is resulted from gene flow from oilseed rape to mustard.
Primer Sequence (5’ to 3’) Product size Annealing temperature

BoKAH45TR- F ATTATGACGCCTGGTTTTA 269 bp 54℃
BoKAH45TR- R ATTGGTTAGAAGTTATGGGAAC
PPT Slide
Lager Image
SSR amplicon generated by the species-specific primer BoKAH45TR, to distinguish between oilseed rape and mustard. Lane 1: oilseed rape; lane 2: mustard; lanes 3 to 107: the progenies (F1 hybrids) of mustard by crossing with oilseed rape.
- 발아특성평가
발아실험은 90 mm 직경의 플라스틱 페트리디쉬에 여과지 1장을 깔고 증류수로 충분히 적신 후 4℃ 항온 종자저장고에 6개월간 보관하였던 유채, 갓, 교잡종의 종자 100립씩을 각각 치상하여 수행되었다. 이후 15℃의 암조건을 유지하는 항온생장상에 넣어 종자가 마르거나 과습하지 않도록 12시간 간격으로 적정량의 수분을 공급하였다. 발아특성 평가는 각 종별로 난괴법 3반복으로 수행되었다. 파종 후 10일 동안 12시간 간격으로 발아종자 수를 조사하였으며, 유근이 2 mm 이상 발생한 종자를 발아된 것으로 간주하였다. 생장상에서 페트리디쉬에 치상 후 10일 까지 발아하지 않은 종자의 종피를 제거하고 2,3,5-triphenyltetrazolium-chloride (TTC) 용액을 처리한 후 빛을 차단시켜 배(embryo)의 색깔변화로 종자의 활력을 판단하였다 (Lakon, 1949) . 발아하지 않은 종자 중 상기한 TTC법에 의해 종자활력이 확인된 종자를 휴면 종자(dormant)로, 그렇지 않은 종자를 사멸종자(dead)로 간주하였다.
- 월하 휴면특성평가
월하 휴면실험은 2013년 6월 8일부터 9월 15일까지 경기도 수원에 위치한 서울대학교 실험농장 야외포장에서 진행되었다. 4℃ 항온 종자저장고에 6개월간 보관하였던 유채, 갓, 교잡종의 종자 100립씩을 플라스틱 망사형 종자봉투에 넣어 토양의 표토조건(0 cm)과 3 cm 토심 조건에 저장기간에 따라 난괴법 3반복으로 매립하였다. 매립 후 각각 0, 10, 20, 40, 60, 80, 100일차에 다시 종자를 꺼내어 발아실험 및 종자활력실험을 차례로 실시하였다. 토양에서 회수한 종자는 증류수로 세척한 후 토양 매립기간 즉, 월하 기간 동안 이미 발아 및 출아한 종자를 조사하였다. 월하 기간 동안 발아하지 않은 종자는 상기한 발아특성 평가와 동일한 조건에서 10일 간 발아여부를 확인하고, 미발아 종자는 TTC법에 따라 종자활력을 평가하였다. 따라서 매립된 종자는 일련의 실험을 통해 월하 기간 중 발아한 종자(pregerminated), 월하 후 발아한 종자(germinated), 미발아 종자 가운데 TTC 평가로 종자(dormant), 미발아 종자가운데 TTC평가로 종자활력이 없는 것으로 확인된 종자(dead)로 구분하였다.
- 월동 휴면특성평가
월동휴면실험은 2014년 2월 13일부터 3월 24일까지는 경기도 수원에 위치한 서울대학교 실험농장 야외포장야외포장에서, 이후 5월 24일까지는 -2℃로 유지되는 항온생장상에서 진행되었다. 4℃ 항온 종자저장고에 14개월간 보관하였던 유채, 갓, 교잡종의 종자를 100립씩 플라스틱 망사형 종자봉투에 넣어 표토조건(0 cm)과 3 cm 토심 조건에 완전임의배치법 3반복으로 매립했다. 매립 100일차에 종자를 꺼내어 증류수로 세척한 후 상기한 방법으로 발아실험과 미발아 종자의 종자활력검정실험을 차례로 진행하였다. 100일간의 월동기간 중 발아한 종자(pregerminated), 월동 후 발아상에서 발아한 종자(germinated), 미발아 종자 가운데 TTC법으로 종자활력이 확인된 종자(dormant), 미발아 종자 가운데TTC 평가에서 종자활력이 없는 것으로 확인된 종자(dead)로 구분하였다.
- 통계분석
파종 후 시간에 따른 누적출아율은 통상적으로 잡초의 발아 및 출아율 해석 및 예측에 사용하는 Gompertz 모델 (Gompertz, 1825) 을 사용하여 분석하였다 (Kim et al., 2006 ; Kim et al., 2010 ; Park et al., 2010) .
Y=C-ee-B(t-M)
  • y: Cumulative germination rate
  • C: Maximum cumulative germination rate
  • B: Initial increasing rate
  • t: Days after seed sowing
  • M: Time required for 50% of maximum cumulative germination rate (C)
종자의 토중 월하 및 월동성과 관련된 토중 종자발아율 및 종자휴면율 등의 특성은 분산분석(ANOVA)을 실시한 후 통계적 유의성이 확인된 경우 각 대상종간의 비교를 위해 Duncan’s multiple range test (DMRT) 또는 least significant difference (LSD) test를 실시하였다. 이상의 모든 통계분석은 Genstat (Genstat 5 Committee, 1997) 을 이용하여 수행되었다.
결과 및 고찰
- 발아특성
부본인 유채, 모본인 갓 및 교잡종의 최초 발아에 소요된 시간을 비교한 결과, 유채가 파종 후 0.5일차로 가장 빨랐으며, 이후 누적발아율이 50%에 도달하는 시간 역시 파종 후 2.5일차로 가장 빨랐다( Fig. 2 ). 일반재배종 갓은 파종 후 8.5일차에 전체 종자의 50%가 발아하였으며, 항온생장상에서의 발아실험이 종료된 10일차까지 52.7%만의 종자가 발아하였다. 반면 교잡종의 최초 발아 소요일은 파종 후 2일차로 유채보다 다소 늦었으나, 파종 후 4일 이내에 누적발아율 50%의 수준에 도달하여 발아세가 갓보다는 높아 유채와 갓의 중간적인 특성을 보여주었다. 시간에 따른 누적발아율을 Gompertz모델에 적용하여 비선형 회귀분석을 수행한 결과( Fig. 2 ) 잘 설명이 되었으며, 최대출아율의 50% 도달기간은 유채 2.18일, 갓 3.17일, 교잡종 2.45일이 각각 소요되어 교잡종의 발아특성은 유채보다는 낮은 발아세를 보였으나 갓에 비해서 훨씬 높은 발아세를 보임을 확인할 수 있었다.
PPT Slide
Lager Image
Cumulative germination rate (%) of OSR (A), mustard (B) and their F1 hybrid (C) resulted from gene flow from OSR to mustard. The continuous line represents the fitted line with the Gompertz model. The parameters C, B, and M represent the maximum cumulative germination rate, the rate of increase of germination once it is initiated, and the days required for 50% of the maximum germination rate, respectively.
최종누적발아율 역시 유채가 96.7%로 가장 높았으며 갓과 교잡종이 각각 52.7, 55.8%로 낮아 교잡종의 발아율은 갓과 유사한 특성을 보였다( Fig. 3 ). 종자의 휴면성은 유채가 1.3%로 가장 낮았고, 갓이 45.3%로 가장 높았으며, 교잡종은 41.1%로 갓의 휴면성과 유사한 높은 값을 보여주었다. 따라서 휴면성만 고려할 때 교잡종은 모본인 갓의 휴면성과 유사한 특성을 보여주어 잡초화 가능성이 높은 것으로 판단되었다.
PPT Slide
Lager Image
The proportion (%) of germinated, dormant, and dead seeds of OSR, mustard and their F1 hybrid resulted from gene flow from OSR to mustard. Germinated seeds are those germinated during germination test, dormant seeds are those ungerminated but confirmed to be viable, and dead seeds are confirmed to be unviable by TTC test. The same letters in the same parameter indicate no significant difference between the tested species by Ducan’s multiple range test (DMRT).
일반적으로 작물은 재배 관리와 수확의 편의를 위해 전체 종자가 일괄적으로 한꺼번에 발아하는 방향으로 선발 및 육종되어왔다. 따라서 발아의 일괄적인 정도를 비교하기 위해 부본, 모본 및 교잡종의 시간에 따른 일평균 발아율과 일평균 발아율 분포에 대한 첨도(kurtosis)를 계산하였다( Table 2 ). 유채의 일일 최대 발아율은 62.1%로서 갓의 12.0%에 비해 5배 이상 높았으며, 교잡종의 일일 최대 발아율은 24.5%로서 유채와 갓의 중간적인 특성을 보여주었다. 일평균 발아율은 교잡종이 2.9%로서4.8%인 유채와 2.6%인 갓의 중간적인 특성을 나타내었으며, 유채보다는 갓과 유사한 특성을 보여주었다. 일평균 발아율 분포에 대한 첨도의 경우도 교잡종이 5.5로서 부본인 유채의 13.1과 모본인 갓의 0.6의 중간적인 특성을 보여주었다. 따라서 이상의 결과를 종합할 때 교잡종의 발아 및 휴면특성은 부본인 유채와 모본인 갓의 중간적인 특성을 띠지만 유채보다는 갓에 보다 근접한 특성을 보여주는 것을 확인할 수 있었다.
Daily germination rate (%) of the F1 hybrid and its parents.
Tested plants Daily germination (%)

Maximum Mean Standard deviation Kurtosis

OSR 62.1 4.8 12.37 13.1
Mustard 12.0 2.6 3.40 0.6
F1 hybrid 24.5 2.9 6.67 5.5
- 월하 및 월동특성
유채와 갓의 교잡종은 월하기간에 관계없이 3 cm 토심에 매립되어 월하할 경우 종자의 월하성이 높게 유지되고 있음을 확인할 수 있었다( Fig. 4 ). 표토조건에서는 저장 후 10, 20일차에 각각 4.2, 3.1%의 교잡종자만이 월하 후 발아하였고, 저장 후 40일차 이후에는 1% 미만의 종자만이 활력있는 종자상태로 월하하였다. 표토 조건에서 교잡종의 월하율(월하후 발아 +휴면 종자 비율)은 월하기간이 길어짐에 따라 급격히 감소하는 경향을 보였고, 3 cm 토심 조건에서는 월하기간과 월하율 사이의 상관은 거의 없었으나 월하 종자가운데 휴면종자의 비율이 다소 높아지는 경향을 보여주었다. 교잡종의 월하휴면율 역시 표토 조건에서는 항상 1% 미만으로 조사되었으나 3 cm 토심 조건에서는 월하 후 40일차부터 월하휴면율이 증가하는 경향을 보여 100일차에는 16.5%의 종자가 휴면하여 월하기간이 길어짐에 따라 휴면종자의 비율이 증가함을 보여주었다. 따라서 여름의 고온다습조건에서는 토양중에 매립되어 월하한 종자가 높은 월하특성을 유지할 수 있음을 시사하였으며, 이러한 종자휴면은 저장기간중의 외부환경변화에 반응한 2차휴면으로 사료된다.
PPT Slide
Lager Image
The proportion (%) of over-summered seeds of OSR (A, D), mustard (B, E) and their F1 hybrid (C, F) resulted from gene flow from OSR to mustard with different periods of seed burial. The seeds were buried at soil surface (A, B, C) and in 3 cm soil depth (D, E, F). ‘Germinated’ indicates the seeds un-germinated during seed burial in soil and germinated on a petri dish placed in the growth chamber maintained at 15℃ after the each duration of seed burial. ‘Dormant’ indicates the seeds confirmed to be viable by TTC test after the each duration of seed burial. The bars in the above right corner of each graph are least significant difference at
교잡종의 월하율(월하후 발아 +휴면종자비율)을 부본인 유채와 모본인 갓에 비교한 결과, 표토조건에 월하한 경우 10, 20일차에는 교잡종이 부모종에 비해 월하율이 높지 않았다( Fig. 4 ). 그러나 월하 후 40일 이후에는 월하휴면력을 상실한 부모종과는 달리 교잡종은 낮지만 일정한 월하휴면성을 유지하여 월하 후 100일까지 지속적으로 월하휴면종자가 존재하였다. 반면 3 cm 토심조건에서 월하한 경우, 전체 저장기간 동안 교잡종의 월하율은 부모종에 비해 항상 높았다.
종자의 월동특성을 종자를 토중에 매립한 후 100일간의 월동 후 평가한 결과, 월하특성과 대조적인 결과를 얻을 수 있었다( Fig. 5 ). 표토 조건에서 월하 후 100일차에 부모종은 전혀 월하하지 못하였고 교잡종의 월하율도 0.9%에 불과하였으나( Fig. 5 A), 월동율(월동 후 발아 +휴면 종자비율)은 각각 71.7, 39.0, 83.5%로 매우 높았다( Fig. 5 C). 반면 3cm 토심 조건에서는 월동율이 각각 0.0, 11.3, 0.9%로서( Fig. 5 D) 월하율 33.7, 63.3, 74.6%( Fig. 5 C) 보다 훨씬 낮아 월하특성과 반대적인 경향을 보여주었다. 위와 같은 교잡종자의 월동 및 월하특성은 생태계 내로 교잡종의 종자가 유출되었을 경우 계절조건과 경운방식에 따라 교잡종이 토양중에서 월하 또는 월동을 통해 잡초화될 가능성이 있음을 시사하며, 반대로 계절에 따라 경운방식을 달리하여 교잡종의 잡초화 가능성을 낮출 수 있음도 시사한다.
PPT Slide
Lager Image
The proportion (%) of pre-germinated seeds during seed burial and germinated, dormant, and dead seeds after 100 days of seed burial in summer (A, B) and winter (C, D) of OSR, mustard and their F1 hybrid resulted from gene flow from OSR to mustard. The seeds were buried on a soil surface (A, C) and 3 cm (B, D) in the soil. ‘Pre-germinated’ indicates the seeds germinated during the period of seed burial and ‘germinated’ indicates those un-germinated during the period of seed burial in soil and germinated in a petri dish maintained in the growth chamber at 15℃ after seed burial. ‘Dormant’ indicates those un-germinated after seed burial but confirmed to be viable by TTC test, while ‘dead’ indicates those confirmed to be unviable by TTC test. The same letters in the same parameter indicate no significant difference between the tested species by Ducan’s multiple range test (DMRT).
교잡종의 월하 및 월동특성을 부모종과 비교 분석한 결과, 교잡종은 겨울조건에서 표토에 저장된 경우 높은 월동율을 보였고, 여름조건에서는 3 cm 토심조건에서 높은 월하율을 보였다. 이는 자연 생태계 내에서 월하 및 월동조건이 최적화될 경우 교잡종이 부모종에 비해 생태계 내 잔존위험성이 더 높음을 의미하며, 동시에 계절조건에 따른 적절한 경지관리방식이 중요함을 시사한다. 즉, 교잡종이 생태계 내로 유출되었을 위험이 감지된 시기가 여름일 경우 무경운 방식으로, 반대로 겨울일 경우에는 경운을 통해 교잡종의 장기적인 잡초화 가능성을 낮출 수 있을 것으로 사료된다.
이와 같은 교잡종의 토심조건 및 계절조건에 따른 휴면 특성은 유채 종자의 주기별 휴면특성에 관한 기존연구 결과와도 일치한다 (Gulden et al., 2004b ; Simard et al., 2002 ; Pekrun et al., 1997) . 선행 연구에서는 6℃와 12℃ 조건의 생장상에서 유채종자의 발아 및 휴면에 대한 적색광 혹은 암 처리효과를 비교하였고, 이를 통해 토심 조건에서 적색광이 부족하여 피토크롬이 불활성화되기 때문에 유채 종자의 휴면이 발생한다고 보고하였다 (López-Granados and Lutman, 1998) . 여름 포장조건에서 토심에 따른 유채의 휴면성을 연구한 또 다른 논문에서는 유채종자는 표토조건(0 cm)에서 저장 직후 휴면율이 급격히 감소하며, 심토조건(10 cm)에서는 종자 자체의 유전적인 요인에 따라 휴면율이 결정된다고 보고한 바 있다 (Gulden et al., 2004a) . 그러나 기존의 연구들은 종자 저장의 토심 또는 계절의 한 가지 요인만 설정하여 종자 휴면의 토심 및 계절에 따른 종자활력의 역학적인 변화를 충분히 설명하지는 못하였다. 월하성이 높은 벼와 월하성이 낮은 벼를 부모본으로 하여 얻은 제1세대 교잡종은 토양 심도에 관계없이 부모종의 중간 정도의 휴면성을 지닌다고 보고한 바 있어 품종 간 휴면 특성이 다르게 나타날 가능성도 시사하였다 (Gu et al., 2003) . 따라서 다양한 유채 품종 및 유채와 동종, 동속 작물의 휴면성을 확인하여 배추과 식물 특이적으로 높은 종자 휴면성을 가졌는지, 혹은 유채-갓 교잡에서 얻은 종자가 특이적으로 높은 휴면특성을 획득한 것인지에 관한 추가적인 연구가 필요하다.
- 근연 교잡종의 잡초화 가능성
이상의 연구결과를 통하여 최초발아 소요기간, 발아속도, 최종발아율 등의 발아특성에서 교잡종은 부모종의 중간 특성을 지닌 것으로 확인되었다, 또한 월하 및 월동특성은 토양심도 조건에 따라 상이했는데, 여름에는 3 cm 토심 조건, 겨울에는 표토조건에 있던 종자의 월하 및 월동성이 더 높았다. 특히 여름 3 cm 토심 조건과 겨울 표토조건이라는 월하 및 월동을 위한 최적조건에서 유채-갓 교잡종은 부모종보다 항상 월하 및 월동성이 각각 높게 유지되어 휴면성 측면에서 교잡종의 잡초화 가능성을 시사하고 있다.
한국은 유채와 교잡 가능한 배추과 작물이 소규모 농지에서 다양하게 재배되는 경우가 많고, 남부지방에는 배추과 잡초로서 야생갓 등이 자생하고 있다 (Kwon et al., 2001b) . 또한 기존의 연구에서 유채와 근연종은 수정 전 장애(prezygotic barrier)가 낮아 다양한 조합으로 교잡이 가능하여 종자를 생산할 가능성이 높은 것으로 알려져 있다. 따라서 국내에 비의도적으로 유전자변형 유채가 유출되거나 유전자변형 유채가 작물로서 본격적으로 도입될 경우 유전자 이동에 따른 근연종과의 교잡종의 잡초화 가능성이 우려되어 왔다. 이러한 관점에서 본 연구에서 확인된 유채와 갓의 교잡종의 높은 휴면성과 월하 및 월동특성은 유전자변형 유채의 유전자이동에 의한 갓과의 교잡종이 잡초화 가능성이 있음을 시사하고 있다.
유채-갓의 교잡종의 잡초화 가능성은 본 연구에서 확인한 발아휴면성, 월하 및 월동 가능성으로 만으로는 판단할 수는 없다. F1교잡종이 임성을 갖고 후대 종자를 생산할 수 있는가에 대한 판단도 필요하다. 유채의 반수체의 염색체수는 19개(n = 19)이며, 갓의 반수체의 염색체수는 18개(n = 18)이다. 따라서 이들간의 교잡에 의해 형성된 교잡종은 이론적으로 불임이 될 확률이 매우 높다. 따라서 만약 유전자 이동에 따른 교잡종이 불임이라면 비록 교잡종의 종자의 휴면성, 월하 및 월동성이 높다 하여도 잡초화의 위험성은 없다고 단정하여도 무리가 아닐 것이다. 그러나 이런 이질 반수체를 갖는 이종간의 교잡에 의한 교잡종의 경우 임성이 유지되어 자가교배 혹은 부모종 각각과의 여교배를 통해 F2 및 BC1세대 종자를 생산하는 사례 (Liu et al., 2010) 도 있기에 향후 연구에서 유채와 갓의 교잡종의 임성과 종자생산 가능성에 대한 추가적인 연구가 필요하다. 또한 F2 이후 세대에서 종자생산이 가능할지라도 이들 후대종이 자연생태계 내에서 잡초화되기 위해서는 얼마나 높은 경합력을 유지하여 주변 잡초들과 경합을 통해 생존할 수 있는지에 대한 검토도 필요하다. 따라서 본 연구에서 확인된 F1 교잡종의 발아 휴면 및 월하/월동성의 결과만으로는 교잡종의 잡초화 가능 여부를 속단하기 어려우며 차후 연구에서 교잡종의 생식능력과 후대의 자연생태계 적응능력 평가(fitness cost test)를 통해서 최종적인 잡초화 가능성을 판단할 수 있을 것이다.
Acknowledgements
This research was supported by Rural Development Administration, Republic of Korea (Project code PJ008375), Project of LMO Environmental Risk Assessment Center).
References
Andersson M.S. , de Vicente C. 2010 Gene flow between crops and their wild relatives. Johns Hopkins Univ. Press Baltimore, Maryland, USA 3 - 37
Bing D.J. , Downey R.K. , Rakow G.F.W. 1996 Hybridizations amongBrassica napus,B. rapaandB. junceaand their two weedy relativesB. nigraandSinapis arvensisunder open pollination conditions in the field. Plant Breeding 115 (6) 470 - 473    DOI : 10.1111/j.1439-0523.1996.tb00959.x
Colton R.T. , Sykes J.D. 1992 Canola. Department of Agriculture N.S.W. USA
Di K. , Stewart C.N. , Wei W. , Shen B.C. , Tang Z.X. 2009 Fitness and maternal effects in hybrids formed between transgenic oilseed rape (Brassica napusL.) and wild brown mustard (B. juncea(L.) Czern et Coss.) in the field. Pest Manag. Sci. 65 (7) 753 - 760    DOI : 10.1002/ps.1749
Genstat 5 Committee 1997 Genstat 5 release 4.1:Reference manual supplement to Genstat 5 Committee (1993) Genstat 5 reference manual release 3. Numerical Algorithms Group Oxford, UK
Gompertz B. 1825 On the nature of the functions expressive of the law of human mortality, and on a new mode of determining the value of life contingencies. Philo. Trans. 115 513 - 585    DOI : 10.1098/rstl.1825.0026
Gulden R.H. , Thomas A.G. , Shirtliffe S.J. 2004a Relative contribution of genotype, seed size and environment to secondary seed dormancy potential in Canadian spring oilseed rape (Brassica napus). Weed Res. 44 97 - 106    DOI : 10.1111/j.1365-3180.2003.00377.x
Gulden R.H. , Thomas A.G. , Shirtliffe S.J. 2004b Secondary dormancy, temperature, and burial depth regulate seedbank dynamics in canola. Weed Sci. 52 (3) 382 - 388    DOI : 10.1614/WS-03-123R1
Gu X.Y. , Chen Z.X. , Foley M.E. 2003 Inheritance of seed dormancy in weedy rice. Crop Sci. 43 (3) 835 - 843    DOI : 10.2135/cropsci2003.8350
Jørgensen R.B. , Andersen B. , Landbo L. , Mikkelsen T.R 1994 Spontaneous hybridization between oilseed rape (Brassica napus) and weedy relatives. In ISHSBrassicaSymposium-IX Crucifer Genetics Workshop 407 193 - 200
Kim D.S. , Kwon Y.W. , Lee B.W. 2006 Mathematical description of seedling emergences of rice andEchinochloaspecies as influenced by soil burial depth. Kor. J. Crop Sci. 51 362 - 368
Kim D.Y. , Nam K.J. , Moon Y.S. , Kim D.I. , Kim Y.J. 2012 Monitoring of the escape of introduced genes of transgenic oilseed rapes outside the trial site in a confined field trial. J. Kor. Soc. Int. Agri. (In Korean) 24 (2) 241 - 246
Kim J.W. , Moon B.C. , Lim S.H. , Chung J.H. , Kim D.S. 2010 Prediction of seedling emergence and early growth ofEleocharis kuroguwaiOhwi under elevated temperature. Kor. J. Weed Sci. 30 (2) 94 - 102    DOI : 10.5660/KJWS.2010.30.2.094
Korea Biosafety Clearing House 2014 Key Statistic of Gene Modified Organisms. Daejeon, Korea (In Korean)
Kwon Y.W. , Kim D.S. , Yim K.O. 2001a Herbicide-resistant genetically modified crop: Assessment and management of gene flow. Weed Biol. Manag. 1 (2) 96 - 107    DOI : 10.1046/j.1445-6664.2001.00022.x
Kwon Y.W. , Kim D.S. 2001b Herbicide-resistant geneticallymodified crop: Its risks with an emphasis on gene flow. Weed Biol. Manag. 1 (1) 42 - 52    DOI : 10.1046/j.1445-6664.2001.00001.x
Lakon G. 1949 The topographical tetrazolium method for determining the germinating capacity of seeds. Plant Physiol. 24 389 - 394    DOI : 10.1104/pp.24.3.389
Liu Y.B. , Wei W. , Ma K.P. , Darmency H. 2010 Backcrosses toBrassica napusof hybrids betweenB. junceaandB. napusas a source of herbicide-resistant volunteer-like feral populations. Plant Sci. 179 (5) 459 - 465    DOI : 10.1016/j.plantsci.2010.07.005
Louarn S. , Torp A.M. , Holme I.B. , Andersen S.B. , Jensen B.D. 2007 Database derived microsatellite markers (SSRs) for cultivar differentiation inBrassica oleracea. Genet. Resour. Crop Ev. 54 (8) 1717 - 1725    DOI : 10.1007/s10722-006-9181-6
López-Granados F. , Lutman P.J. 1998 Effect of environmental conditions on the dormancy and germination of volunteer oilseed rape seed (Brassica napus). Weed Sci. 46 (4) 419 - 423
National Institute of Environmental Research 2012 A study on environmental monitoring and post-management of LMO (IV). Incheon, Korea (In Korean)
National Institute of Environmental Research 2013 Development of techniques and protocols for risk assessments of gene flow from LM crops to its relatives in Korea (II). Incheon, Korea (In Korean)
Park M.W. , Kim J.W. , Lim S.H. , Lee I.Y. , Kim D.S. 2010 Prediction of seedling emergence and early growth ofMonochoria vaginalisandScirpus juncoidesunder elevated temperature. Kor. J. Weed Sci. 30 (2) 103 - 110    DOI : 10.5660/KJWS.2010.30.2.103
Pekrun C. , Potter T.C. , Lutman P.J.W. Genotypic variation in the development of secondary dormancy in oilseed rape and its impact on the persistence of volunteer rape. Proc. Brighton Crop Prot. Council Conf. – Weeds, BCPC, Farnham, Surrey, UK 1997 243 - 248
Simard M.J. , Légère A. , Pageau D. , Lajeunesse J. , Warwick S. 2002 The frequency and persistence of volunteer canola (Brassica napus) in Québec cropping systems. Weed Tech. 16 433 - 439    DOI : 10.1614/0890-037X(2002)016[0433:TFAPOV]2.0.CO;2
Snow A.A. , Andow D.A. , Gepts P. , Hallerman E.M. , Power A. 2005 Genetically engineered organisms and the environment: Current status and recommendations 1. Ecol. Appl. 15 (2) 377 - 404    DOI : 10.1890/04-0539
Tsuda M. , Okuzaki A. , Kaneko Y. , Tabei Y. 2012 Relationship between hybridization frequency ofBrassica juncea× B. napusand distance from pollen source (B. napus) to recipient (B. juncea) under field conditions in Japan. Breeding Sci. 62 (3) 274 - 281    DOI : 10.1270/jsbbs.62.274