Advanced
Molecular Identification of Pooideae, Poaceae in Korea
Molecular Identification of Pooideae, Poaceae in Korea
Weed & Turfgrass Science. 2015. Mar, 4(1): 18-25
Copyright © 2015, The Korean Society of Weed Science and The Turfgrass Society of Korea
This is an Open-Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/3.0) which permits unrestricted noncommercial use, distribution, and reproduction in any medium, provided the original work is properly cited.
  • Received : December 18, 2014
  • Accepted : February 03, 2015
  • Published : March 31, 2015
Download
PDF
e-PUB
PubReader
PPT
Export by style
Share
Article
Author
Metrics
Cited by
About the Authors
Jeongran Lee
kongsarang@korea.kr
Chang-Seok Kim
In-Yong Lee

Abstract
DNA 바코드는 게놈 DNA의 단편을 이용해 형태적 지식 없이 종을 동정하는 방법으로 전 세계적으로 최근에 많이 이용하고 있으며 고등식물에서는 엽록체 rbc L과 mat K 유전자를 이용하고 있다. 본 연구에서는 표준 식물 바코드마커와 핵 ITS 부위를 이용하여 국내 포아풀아과 잡초 16속 29종 163생태형의 바코드 데이터를 생산하는 것을 목적으로 하였다. 더불어 포아풀아과의 바코드에서 각 마커의 효율성도 조사하였다. 바코드 결과 PCR 증폭과 염기서열 분석성공률은 rbc L에서 가장 높았으며 mat K에서 가장 낮았다. 반대로 바코드 갭은 mat K에서 가장 높은 반면 rbc L에서 가장 낮았으며, 종 식별 해상력은 mat K에서 가장 높고, ITS에서 가장 낮았다. 그러나 바코드 갭과 종 식별 해상력이 가장 높은 mat K를 포아풀아과에서 바코드 마커로 이용하는 것은 너무 낮은 PCR 증폭과 염기서열 분석성공률(58.3%) 때문에 고려해야할 것으로 생각된다. 단일마커로 rbc L과 ITS는 포아풀아과의 바코드에 적절하게 이용될 수 있으며, 두 마커를 조합으로 이용하면 공통으로 분석된 샘플에 따라 바코드 갭과 종 식별 해상력을 높일 수 있었다. 포아풀아과의 바코드데이터는 미국의 국립생물공학정보센터에 기탁하여 genbank 번호를 부여받아 공개하였다.
Keywords
서 론
전 세계에 약 700속 11,000여 종을 포함하는 벼과(Poaceae Barnhart) 식물은 곡물, 사탕수수, 대나무, 사료 등을 포함하기 때문에 경제적 가치가 매우 높은 반면, 농경지에서 문제가 되는 악성 잡초를 많이 포함하는 분류군이기도 하다 (Grass Phylogeny Working Group, 2001) . 국내에서 벼과 식물은 약 6아과, 96속, 252분류군이 분포하는데 그 중에서 포아풀아과는 벼과 식물의 50%인 39속, 126분류군을 포함하는 가장 큰 아과이며 (Park et al., 2011) 농경지에서 문제시되고 있는 뚝새풀( Alopecurus aequalis Sobol.)과 새포아풀( Poa annua L.) 등 잡초를 다수 포함하고 있다. 벼과식물은 영과의 독특한 형질에 의해 다른 과의 식물들과는 비교적 쉽게 구분이 되지만 벼과 내에서는 전문가의 도움 없이 정확한 동정을 하는 것이 쉽지않다. 그러나 전 세계적으로 형태분류학자는 점점 줄어들고 있는 실정으로 종을 빠르고 정확하게 동정하는 것이 점점 어려운 현실이 되고 있다.
DNA 바코드는 게놈의 짧은 표준 범위를 이용하여 형태적 분류 지식없이 종을 빠르고 쉽고 정확하게 동정하기 위한 방법으로 Hebert et al. (2003) 에 의해 제안되어, 형태분류학자의 부재하에서 형태학적으로 동정하기 어려운 분류군을 동정하는 대안으로 최근에 매우 활발하게 이용되고 있다. 동물에서는 미토콘드리아 CO1 유전자를 DNA 바코드 표준 유전자로 이용하고 있으나 고등식물에서는 엽록체 DNA의 rbc L과 mat K 조합의 이용을 권고하고 있다 (CBOL Plant Working Group, 2009) . 그러나 rbc L과 mat K 조합만으로는 종을 적절하게 동정하기 어려운 경우가 종종 있다. 예를 들면, Consortium for Barcode of Life (CBOL) Plant Working Group (2009) 은 고등식물의 주요 계보를 대표하는 440종 907 샘플을 rbc L과 mat K 조합으로 바코드한 결과 72%의 정확한 종동정 성공률을 얻었고 나머지는 같은 속내에 속하는것으로 분석되었다. 그러므로 엽록체 DNA의 non-coding 부위인 trn H- psb A나 진화속도가 빠른 핵 ribosomal internal transcribed spacer (ITS) 부위를 함께 바코드에 이용하면 보완이 될것이라는 많은 주장이 있다 (Chen et al., 2010 ; Kress and Erickson, 2007) .
따라서 본 연구는 농경지에 발생하는 포아풀아과 잡초를 대상으로 엽록체 DNA의 rbc L과 mat K, 핵 ITS 부위를 바코드하고 그 결과를 미국 국립생물공학정보센터(National Center for Biotechnology Information, NCBI)에 등록하여 일반인들이 쉽게 이용할 수 있는 기초 자료를 축적하고자 수행하였다.
재료 및 방법
- 식물 재료
경기도, 강원도, 충청도, 전라도, 경상도, 제주도와 울릉도 등 전국에서 29종 128생태형을 채집하고, 국립생물자원관에서 17종 35생태형의 표본을 대출하여 총 29종 163생태형의 엽록체 DNA의 rbc L과 mat K, 핵 ITS 부위의 염기서열을 분석하였다( Table 1 ). 본 연구에 이용한 식물재료는 Chen and Peterson (2006) Park et al. (2011) 에 근거하여 동정하였다. 전국에서 채집한 128점은 확증표본을 제작하여 국립농업과학원 표본관(HCCN)에 보관하였다. 바코드 염기서열은 미국의 국립생물공학정보센터에 제출하여 GenBank 번호를 부여받아 공개하였다.
Plant materials used in this study.
Scientific name Korean name No. of samples Sample ID

Agrostis clavata Heengyeoisak 3 PB-257 (Gyeonggi), NIBR-13 (Jeonbuk), NIBR-33 (Jeonbuk)
Alopecurus aequalis Ttuksaepul 5 PB-5 (Gyeonggi), PB-13 (Jeonnam), PB-33 (Gangwon), PB-45 (Gyeongbuk), PB-69 (Gyeonggi)
Alopecurus japonicus Teolttuksaepul 3 PB-14 (Jeonnam), NIBR-30 (Jeju), NIBR-39 (Gangwon)
Avena fatua Maegwiree 3 PB-9 (Jeonnam), NIBR-60 (Jeju), NIBR-58 (Gyeonggi)
Beckmannia syzigachne Gaepee 7 PB-12 (Jeonnam), PB-20 (Jeonnam), PB-29 (Gyeonggi), PB-56 (Choongnam), PB-68 (Gyeonggi), PB-85 (Gangwon) NIBR-37 (Daegu)
Bromus catharticus Keunyisakpul 7 PB-11 (Jeonnam), PB-94 (Gyeonggi), PB-130 (Gyeongnam) PB-136 (Gyeongbuk), PB-164 (Jeonbuk), PB-190 (Gyeongbuk), PB-320 (Jeju)
Bromus inermis Jomchamsaegwiree 4 PB-31 (Gyeonggi), PB-36 (Gyeongbuk), PB-53 (Choongnam), PB-198 (Gyeongbuk)
Bromus japonicus Chamsaegwiree 6 PB-23 (Jeonnam), PB-49 (Gyeongbuk), PB-57 (Choongnam), PB-60 (Gyeonggi), PB-86 (Gangwon), PB-7 (Gyeonggi)
Bromus rigidus Ginggarakbipsaegwiree 6 PB-15 (Jeonnam), PB-58 (Choongnam), PB-383 (Jeonnam), NIBR10 (Incheon), NIBR-54 (Jeju), PB-51 (Choongnam)
Bromus tectorum Teolbipsaegwiree 6 PB-50 (Choongnam), PB-81 (Gyeonggi), PB-83 (Gangwon), PB-384 (Jeonnam), PB-389 (Gangwon), PB-395 (Choongnam)
Calamagrostis epigeios Sanjopul 8 PB-89 (Gangwon), PB-95 (Gyeonggi) PB-103 (Gyeonggi), PB-113(Choongnam), PB-143 (Incheon), PB-201 (Gyeongbuk) NIBR-40 (Choongnam), NIBR-27 (Jeonbuk)
Dactylis glomerata Orisae 8 PB-4 (Gyeonggi), PB-10 (Jeonnam), PB-34 (Gangwon), PB-64 (Gyeonggi), PB-141 (Incheon), PB-193 (Gangwon), PB-209 (Choongnbuk), PB-276 (Gyeongnam)
Elymus ciliaris Sokteolgaemil 5 PB-2 (Gyeonggi), PB-24 (Jeonnam), PB-180 (Gangwon), PB-208 (Choongnbuk), PB-65 (Gyeonggi)
Elymus dahuricus Gaetbori 6 PB-226 (Gyeonggi), PB-242 (Choongnam), PB-391 (Choongnam), PB-398 (Incheon), NIBR-47 (Jeonnam), NIBR-52 (Jeonbuk)
Elymus mollis Gaetgeuryeong 2 PB-390 (Jeonnam), PB-392 (Choongnam)
Elymus repens Goojoogaemil 8 PB-22 (Gyeonggi), PB-144 (Incheon), PB-181 (Gangwon), PB-184 (Gyeongbuk), PB-217 (Choongnbuk), NIBR-36 (Jeju), NIBR-43 (Gyeongbuk), PB-111 (Choongnam)
Elymus repens f. arisatum Ggarakgoojoogaemil 2 PB-93 (Gangwon), NIBR-2 (Incheon)
Elymus tsukushiensis Gaemil 6 PB-21 (Gyeonggi), PB-25 (Jeonnam), PB-40 (Gyeongbuk), PB-71 (Gyeonggi), PB-128 (Gyeongnam) PB-182 (Gyeongbuk)
Festuca arundinacea Keungimeuteol 6 PB-35 (Gangwon), PB-46 (Gyeongbuk), PB-47 (Gyeonggi), PB-61 (Gyeonggi), PB-162 (Jeonbuk), PB-200 (Gyeongbuk)
Hierochloe odorata Hyangmo 4 PB-28 (Gyeonggi), PB-379 (Gangwon), NIBR-17 (Choongnbuk), NIBR-59 (Daegu)
Lolium multiflorum Jwibori 5 PB-18 (Jeonnam), PB-381 (Jeonnam), NIBR4 (Incheon), NIBR-18 (Jeju), NIBR-42 (Daegu)
Lolium perenne Homilpul 4 PB-66 (Gyeonggi), NIBR-28 (Jeonnam), NIBR-55 (Gangwon), NIBR-19 (Jeonnam)
Phalaris arundinacea Galpul 9 PB-43 (Gyeongbuk), PB-52 (Choongnam), PB-59 (Choongnam), PB-63 (Gyeonggi), PB-84 (Gangwon), PB-183 (Gyeongbuk), PB-195 (Gangwon), NIBR-21 (Jeonbuk), NIBR-48 (Jeonbuk)
Poa annua Saepoapul 8 PB-1 (Gyeonggi), PB-17 (Choongnam), PB-19 (Jeonnam), PB-67 (Gyeonggi), PB-110 (Choongnam), PB-189 (Gangwon), PB-207 (Choongnbuk), NIBR-15 (Jeju)
Poa pratensis Wangpoapul 3 PB-3 (Gyeonggi), PB-27 (Jeonnam) PB-38 (Gyeongbuk)
Polypogon fugax Soeidolpee 6 PB-26 (Jeonnam), PB-221 (Jeonnam), PB-382 (Jeonnam), NIBR-44 (Gyeongbuk), NIBR-25 (Jeju), NIBR-38 (Busan)
Polypogon monspeliensis Gaetsoeidolpee 2 PB-394 (Choongnam), NIBR-49 (Jeonnam) PB-62 (Gyeonggi), PB-72 (Gyeonggi), PB-78 (Choongnam), PB-90 (Gangwon), PB-157 (Jeonbuk), PB-385 (Jeonnam), PB-386
Trisetum bifidum Jamjaripee 13 (Incheon), PB-388 (Gangwon), PB-393 (Choongnam), NIBR-24 (Gyeongnam), NIBR-50 (Gyeongbuk, NIBR-16 (Gyeongnam), NIBR-41 (Gyeongnam)
Vulpia myuros Deulmooksae 8 PB-55 (Choongnam), PB-74 (Gyeonggi), PB-139 (Incheon), PB-156 (Jeonbuk), PB-378 (Jeju), PB-380 (Jeonnam), PB-387 (Incheon), PB-76 (Choongnam)
- DNA 추출, PCR 증폭, 염기서열 분석
전체 게놈 DNA는 Genomic DNA Isolation Kit (NucleoGen, Germany)를 이용하여 제공하는 프로토콜에 따라 추출하였다. 추출한 DNA는 Nanodrop ND-1000을 이용하여 DNA의 농도와 순도를 측정한 후 25ng μL -1 로 맞추어 PCR 증폭에 이용하였다.
엽록체 rbc L과 mat K, 핵 ITS의 PCR 증폭반응에 이용한 프라이머와 증폭온도는 Lee et al. (2014) 을 따랐으며 rbc L의 증폭을 위하여 forward primer의 염기서열을 일부 수정하여 이용하였다( Table 2 ). PCR 증폭반응과 정제는 Lee and Hymowitz (2001) 에 따랐다. 염기서열 분석은 대전의 GenoTech에서 수행하였다.
Primers and reaction conditions used in this study.
Barcode region Primer Primer sequences Annealing temperature (℃) Reference

rbcL rbcL_7F modified GGGAC(T/G)TATGTCACCACAAAC 55-50 touchdown Ingram et al. (2011)
rbcL_1369R TTCCATAYTTCACAAGCTGC Christin et al. (2008)
matK W TACCCTATCCTATCCAT 55-50 touchdown Hilu et al. (1999)
trnK-2R AACTAGTCGGATGGAGTAG Johnson and Soltis (1995)
ITS ITS4 TCCTCCGCTTATTGATATGC 57 White et al. (1990)
ITS-Y5 TAGAGGAAGGAGAAGTCGTAACAA Kita and Ito (2000)
- 바코드 분석
분석된 염기서열은 Lasergen 8.1.5 (CodonCode Corp, Dedham, MA, USA)를 이용하여 contig를 작성하고 Clustal W를 이용하여 정렬한 후 육안 편집을 거쳤다. 각 마커별 그리고 rbc L과 mat K, ITS 조합의 분류군간, 분류군내 염기서열 변이는 MEGA 6.06 프로그램을 이용하여 Kimura 2-Parameter (K2P) distance model로 산출하였고 (Tamura et al., 2013) 최소 종간 변이와 최대 종내 변이를 SigmaPlot 13 (Systat Software Inc., USA)으로 도식화하여 바코드 갭을 조사하였다 (Theodoridis et al., 2012) . Neighbor-joining dendrogram (Saitou and Nei, 1987) 을 작성하여 각 분류군의 단계통 형성여부와 각 마커별 해상력을 확인하였다.
결과 및 고찰
- DNA 염기서열 분석
각 마커별 바코드 염기서열은 미국 국립생물공학정보센터에 제출하여 GenBank 번호를 부여받았다. GenBank 번호는 rbc L 바코드는 KF712931 – KF713076, mat K 바코드는 KF713077 – KF713172, ITS 바코드는 KF713173 – KF713299로 검색이 가능하다. 각 마커별 염기서열 분석 성공률은 rbc L에서 89.6%로 가장 높았고, mat K에서 58.3%로 가장 낮았으며 ITS는 77.3%의 성공률을 보여 좋은 바코드의 조건 중의 하나인 염기서열 분석률은 rbc L이 가장 높았다( Table 3 ). rbc L 과 ITS는 단일 프라이머와 단 한 번의 시도로 PCR 증폭과 염기서열 분석이 성공적으로 진행된 반면, mat K는 기장아과에서와 마찬가지로 중간 프라이머가 필요한 경우가 종종 있었는데 이는 분석하고자 하는 부위에 A-T 서열의 반복이 많아서 일 것으로 추정된다. 또한, mat K는 86.5%의 염기서열 분석 성공률을 보인 기장아과 (Lee et al., 2014) 와 달리 포아풀아과의 염기서열 분석률이 현저히 떨어져 CBOL Plant Working Group (2009) 에서 선정한 표준 마커라 할지라도 현실적으로 포아풀아과의 바코드 마커로써의 사용여부는 고려되어져야 할 것으로 생각된다. 이는 mat K가 분자계통학적 연구에서는 상당히 높은 변이율을 보여주나 PCR 증폭률이 낮고(39.3%), 변이가 많아 보존된 염기서열이 부족하여 더 나은 프라이머를 제작하는데 어려움이 있어 육상식물의 바코드마커로 이용하기에 부족하다는 Kress and Erickson (2007) 의 보고와 일치한다.
Characteristics of the DNA barcodes evaluated in Korean Pooideae, Poaceae.
Barcode (sequenced length) Sequencing success rate (%) (N sequenced samples, N species) Variable sequences (%) Species represented by multiple individuals N species showing intraspecific divergence Interspecific variation (average %) Interspecific variation (average %) Percentage of species exhibiting barcoding gap* Resolving Power (%)*

rbcL (1,096) 89.6 (146, 28) 91 (8.3) 28 9 0~2.60 (1.59) 0~0.49 (0.06) 78.6 25 (89.3)
matK (1,029) 58.3 (95, 28) 215( 20.89) 26 14 0.10~8.31 (4.87) 0~1.09 (0.16) 96.2 24 (92.3)
ITS (664) 77.3 (126, 26) 261 (39.3) 24 18 0.04~22.1 (12.12) 0~2.82 (0.34) 91.7 19 (79.1)
rbcL +matK (2,125) 55.2 (90, 26) 306 (14.4) 24 10 0.05~5.11 (3.13) 0~0.86 (0.10) 95.8 23 (95.8)
rbcL +ITS (1,766) 69.9 (114, 26) 353 (20.0) 23 17 0.01~8.61 (5.24) 0~1.32 (0.16) 91.3 21 (91.3)
matK+ITS (1,699) 46.0 (75, 23) 477 (17.1) 18 15 0.02~12.55 (7.66) 0~4.29 (0.45) 88.9 18 (100)
rbcL +matK + ITS (2,783) 46.6 (76, 24) 568 (19.3) 21 17 0.01~8.29 (5.14) 0~1.13 (0.16) 90.5 17 (85.0)
* Percentage of species exhibiting barcoding gap and resolving power are based on the definition of Theodoridis et al. (2012)
- 종간, 종내 변이와 바코드 해상력
각 분류군별 염기서열 변이는 rbc L에서 8.3%, mat K에서 20.9%, ITS에서 39.3%로 ITS부위에서 가장 높게 나타나서 기장아과에서와 같은 결과를 보였다 (Lee et al., 2014) . 종내변이를 보이는 분류군은 rbc L에서 9분류군, mat K에서 14분류군, ITS에서 18분류군이었으며 이들의 종내 변이율은 평균 0.18%, 0.31%, 0.46%로 ITS구간에서 가장 높은 종내변이율을 보였다. 세개의 바코드마커로 분석된 염기서열을 모두 통합해서 분석한 결과 종내 변이율은 0~1.13%, 평균 0.16%이었다. 오리새( Dactylis glomerata L.), 쥐보리( Lolium multiflorum Lam.), 새포아풀에서는 종내 변이가 없었으며, 왕포아풀( Poa pratensis L.)에서 가장 종내 변이가 많은 것으로 나타났다. 새포아풀, 쥐보리, 오리새는 각 세개의 바코드 마커 뿐만 아니라 모든 바코드 마커 조합( rbc L + mat K, rbc L + ITS, mat K + ITS, rbc L + mat K + ITS)에서 종내 변이를 보이지 않아 국내에서 이 세 종은 단일 생태형을 가질가능성이 높은 것으로 사료된다. 메귀리( Avena fatua L.)와 갯쇠돌피( Polypogon monspeliensis (L.) Desf.)는 rbc L과 ITS를 이용한 바코드에서 종내 변이를 보이지 않았으나 mat K에서 한 가지 생태형만이 분석되어 국내에 분포하는 이 두 분류군의 종내 변이율은 mat K나 다른 마커를 이용하여 추후 더 분석되어져야할 것으로 사료된다( Table 3 ).
단일 마커의 종간 변이율은 rbc L에서 1.59%, mat K에서 4.87%, ITS에서 12.12% 이었다. 세개의 바코드마커 조합의 종간 변이율은 0.01~8.29%, 평균 5.1%이었는데, 뚝새풀과 털뚝새풀( Alopecurus japonicas Steud.)간에는 종간 변이가 없었으며, 참새귀리( Bromus japonicus Thunb.)와 호밀풀( Lolium perenne L.)간에 종간 변이가 가장 큰 것으로 나타났다.
Theodoridis et al. (2012) 은 두개 이상의 생태형을 갖는 분류군이 최대 종내 변이와 최소 종간 변이의 차이가 0보다 클 때 바코드 갭이 있는 것으로 정의하고 있으며 바코드 갭이 충분할 때 좋은 바코드로 규정하고 있다. 각 마커별 바코드 갭을 살펴보면 rbc L이 78.6%, mat K가 96.2%, ITS가 91.7%로 단일 마커에서는 mat K가 가장 높은 바코드 갭을 갖으며 ITS도 91% 이상의 높은 바코드 갭을 갖는 것으로 분석되었다. 각 마커를 조합하면 rbc L과 mat K의 조합에서 95.8%의 높은 바코드 갭을 갖는 반면 rbc L + mat K + ITS 조합에서 가장 낮은 것으로 확인되었다( Table 3 ). 단일 마커(A)와 마커들의 조합(B)에 의한 바코드 갭을 나타낸 플랏에서는 두 플랏간에 큰 차이가 없는 것으로 나타났다( Fig. 1 ).
PPT Slide
Lager Image
Plots of minimum interspecific distance versus maximum intraspecific distances for the individual (left) and the combined barcode regions (right). Each data point represents a species for which two or more individuals were sampled. Species, which fall above the line, exhibit a barcoding gap.
Neighbor-joinging 계통수의 단일계통 형성여부에 근거한 바코드 해상력을 살펴보면 rbc L이 89.3%, mat K가 92.3%, ITS가 79.1%로 단일 마커에서는 mat K가 가장 높았고 ITS에서 가장 낮았다. 그러나 예를 들면, ITS의 계통수에서 쇠돌피( Polypogon fugax Nees ex Steud.)와 갯쇠돌피, 쥐보리와 호밀풀, 뚝새풀과 털뚝새풀, 털빕새귀리( Bromus tectorum L.)와 긴까락빕새귀리( B. rigidus Roth) 같이 단일계통을 형성하지 않은 분류군들은 모두 같은 속내에 포함이 되었다( Fig. 2 ). 그러므로 본 연구에서의 단일계통에 의한 해상력은 각 바코드마커의 종 식별력이라기보다는 분류학적으로 단계원이 아닐 가능성이 높은 분류군들인것으로 사료되며 이들 분류군의 분류학적 재검토가 필요할것으로 생각된다. 조합으로는 mat K + ITS에서 100%의 해상도를 보였으나 mat K와 ITS에서 공통으로 분석된 염기서열분석성공률이 46%로 매우 낮아 포아풀아과의 바코드에 이용하기엔 부적절한 것으로 생각된다( Table 3 ).
PPT Slide
Lager Image
Neighbor-joining tree inferred from the analysis of ITS from Pooideae. Branch lengths are proportional to distances estimated from the two-parameter method of KIMURA. Numbers above the branch indicates the bootstrap supports (%) for 1000 replicated analyses. Grey boxes contain taxa not showing monophyly.
위의 결과들을 요약하면 좋은 바코드의 첫 번째 조건인 각 샘플의 PCR 증폭과 염기서열 성공률은 rbc L과 ITS가 CBOL Plant Working Group (2009) 의 72%의 종 식별력보다 높았고 mat K는 58.3%에 그쳐 매우 낮았지만, mat K는 바코드 갭과 해상도가 각각 96.2%와 92.3%로 매우 높았다. 그러나 mat K 마커의 염기서열 분석성공률이 낮은 점을 고려할 때 포아풀아과 바코드에 mat K를 이용하는 것은 적절치 않은 것으로 생각된다.
육상식물의 표준 바코드 마커 선정에 있어서 초기에는 엽록체 유전자 ( rpo B, rpo C1, rbc L, mat K) 와 non-coding 부위인 trn H- psb A, atp F– atp H, psb K– psb I, 핵 nrITS 등을 고려하였으나 PCR 증폭과 염기서열 분석 성공률, 종 변별력, 프라이머의 보편성 등의 고려요인에 의해 엽록체 유전자 rbc L과 mat K의 조합을 선정하였다 (CBOL Plant Working Group, 2009) . 그러나 여전히 많은 연구에서 분류군에 따라 이들 두 조합만으로는 염기서열에 기초한 종 변별력이 떨어지거나 mat K의 PCR 증폭의 어려움 등을 토론하고 추가적으로 다른 부위의 필요성을 제기하였다 (Ghahramanzadeh et al., 2013 ; Hollingsworth et al., 2011) . Aubriot et al. (2013) 은 그 중에서도 핵 ITS 부위를 이용하여 마다가스카 등대풀속( Euphorbia )을 바코드 하였으며 ITS 단독 또는 mat K와의 조합에서 모두 매우 유용한 결과를 얻었다. 본 연구에서 ITS는 77.3%의 PCR 증폭 및 염기서열 분석성공률과 79.1%의 해상력을 갖는 것으로 분석되어 ITS 단독으로 포아풀아과 바코드 마커로 이용이 가능하다고 생각된다. 그러나 ITS가 rbc L과의 조합에서는 91.3%의 높은 해상력을 나타냈지만 69.9%의 비교적 낮은 PCR 증폭 및 염기서열 분석성공률을 나타내어 한국산 포아풀아과의 바코드에 rbc L과의 조합으로 이용하는 것은 고려를 해야할 것으로 생각된다. 기장아과에서는 세개의 바코드 마커가 모두 비교적 고르게 PCR 증폭 성공률과 해상력을 나타낸 것과 비교하면 포아풀아과는 같은 마커에 의한 바코드에 다소 어려움이 있어 추후 mat K 프라이머의 보완 등이 이루어져야 할 것으로 생각된다 (Lee et al., 2014) .
- 포아풀아과의 분류학적 토론
포아풀아과는 바코드 마커에 따라 분류군간 유연관계에 약간의 차이가 있었다. 예를 들면, 갈풀( Phalaris arundinaceae L.)은 rbc L에서는 각각 산조풀( Calamagrostis epigeios (L.) Roth)과 유연관계를 이루는 생태형과 향모( Hierochloe odorata (L.) P.Beauv.), 흰겨이삭( Agrostis clavata Trin.), 쇠돌피속( Polypogon Desf.)과 유연관계를 나타내는 생태형 그룹으로 크게 두 개의 clade에 나뉘어 유연관계를 나타낸 반면, mat K와 ITS에서는 단계원을 형성하였다. 또한 rbc L에서 쇠돌피속( Polypogon ), 포아풀속( Poa L.), 개피속( Beckmannia Host), 들묵새속( Vulpia C.C.Gmel.), 김의털속( Festuca L.), 호밀풀속( Lolium L.) clade와 유연관계를 갖는 메귀리( Avena fatua L.)는 mat K와 ITS에서는 갈풀속( Phalaris L.), 잠자리풀속( Trisetum Pers.), 향모속( Hierochloe R.Br.), 겨이삭속( Agrostis L.), 산조풀속( Calamagrostis Adans.), 쇠돌피속( Plolypogon )의 clade에 포함이 되는 다른 결과를 보였다. 즉, rbc L과 mat K를 이용한 분석에서 차이를 보였던 유연관계는 ITS를 이용하였을 때 mat K 이용 분석결과와 유사성이 더 높았다. 세 바코드 마커 rbc L과 mat K, ITS의 통합 분석 결과( Fig. 2 ) 세 마커에 공통으로 분석된 샘플수는 76점이었고 이들의 유연관계를 분석한 결과, 하나의 특정 바코드마커를 이용했을 때 다계원을 보이는 등 종내 유연관계에 혼란이 있었던 종들이 통합 분석한 결과 단계원을 형성하는 등 종내 유연관계가 더 지지되는 결과를 얻었다. 그러므로 세 마커에서 공통으로 PCR 증폭과 염기서열 분석에 성공한다면 정확한 종동정을 위하여 하나의 바코드마커보다는 세개 이상의 마커를 통합하여 분석하는 것이 보다 정확한 결과를 얻을 수 있었다. 세 마커 조합의 결과에서도 뚝새풀과 털뚝새풀, 쇠돌피와 갯쇠돌피는 두 분류군간에 혼재되는 결과를 보임으로써 이들 분류군의 종 구명을 위하여 염기서열뿐아니라 형태적 특징 등의 정밀한 연구가 요구된다.
Acknowledgements
This research was supported by a project from the Cooperative Research Program for Agricultural Science & Technology Development (Project No. PJ010068) of the RDA.
References
Aubriot X. , Lowry P.P. , Cruaud C. , Couloux A. , Haevermans T. 2013 DNA barcoding in a biodiversity hot spot: potential value for the identification of MalagasyEuphorbiaL. listed in CITES Appendices I and II. Mol. Ecol. Res. 13 57 - 65    DOI : 10.1111/1755-0998.12028
CBOL Plant Working Group 2009 A DNA barcode for land plants. P. Natl. Acad. Sci. USA. 106 12794 - 12797    DOI : 10.1073/pnas.0905845106
Chen S. , Peterson P.M. Vol.22 Poaceae (Gramineae), In Flora of China, eds. Z. Y. Wu, et al. Missouri Botanical Garden, CO & Harvard Univ Herbaria, MA, USA 651
Chen S. , Yao H. , Han J. , Liu C. , Song J. 2010 Validation of the ITS2 region as a novel DNA barcode for identifying medicinal plant species. PLoS one (8611-8618). 5 e8613 -    DOI : 10.1371/journal.pone.0008613
Christin P.A. , Besnard G. , Samaritani E. , Duvall M.R. , Hodkinson T.R. 2008 Oligocene CO2decline promoted C4photosynthesis in grasses. Curr. Biol. Suppl. Data S1 - S13
Ghahramanzadeh R. , Esselink G. , Kodde L.P. , Duistermaat H. , van Valkenburg J.L.C.H. 2013 Efficient distinction of invasive aquatic plant species from non-invasive related species using DNA barcoding. Mol. Ecol. Res. 13 21 - 31    DOI : 10.1111/1755-0998.12020
Grass Phylogeny Working Group 2001 Phylogeny and subfamilial classification of the grasses (Poaceae). Ann. Missouri Bot. Gard 88 373 - 457    DOI : 10.2307/3298585
Hebert P.D.N. , Cywinska A. , Ball S.L. , Waard J.R.d. 2003 Biological identifications through DNA barcodes. P. R. Soc. London, Series B 270 313 - 321    DOI : 10.1098/rspb.2002.2218
Hilu K.W. , Alice L.A. , Liang H. 1999 Phylogeny of Poaceae inferred frommatK sequences. Ann. Missouri Bot. Gard. 86 835 - 851    DOI : 10.2307/2666171
Hollingsworth P.M. , Graham S.W. , Little D.P. 2011 Choosing and using a plant DNA barcode. PLoS ONE 6 1 - 13    DOI : 10.1371/journal.pone.0019254
Ingram A.L. , Christin P.A. , Osborne C.P. 2011 Molecular phylogenies disprove a hypothesized C4 reversion inEragrostis walteri(Poaceae). Ann. Bot. 107 321 - 325    DOI : 10.1093/aob/mcq226
Johnson L.A. , Soltis D.E. 1995 Phylogenetic inference in Saxifragaceae sensu stricto an Gilia (Polemoniaceae) usingmatK sequences. Ann. Missouri Bot. Gard. 82 149 - 175    DOI : 10.2307/2399875
Kita Y. , Ito M. 2000 Nuclear ribosomal ITS sequences and phylogeny in East AsianAconitumsubgenusAconitum(Ranunculaceae), with special reference to extensive polymorphism in individual plants. Plant Syst. Evol. 225 1 - 13    DOI : 10.1007/BF00985455
Kress W.J. , Erickson D.L. 2007 A two-locus global DNA barcode for land plants: the coding rbcL gene complements the non-codingtrnH-psbA spacer region. PLoS ONE 2 e508 -    DOI : 10.1371/journal.pone.0000508
Lee J. , Hymowitz T. 2001 A molecular phylogenetic study of the subtribe Glycininae (Leguminosae) derived from the chloroplast DNArps16 intron sequences. Am. J. Bot. 88 2064 - 2073    DOI : 10.2307/3558432
Lee J. , Kim C.S. , Lee I.Y. 2014 Evaluating the Discriminatory Power of DNA Barcodes in Panicoideae, Poaceae. J. Agri. Sci. Tech. B 4 533 - 544
Park S.H. , Lee Y.M. , Chung S.Y. , Chang G.S. , Kang W.C. 2011 Illustrated grasses of Korean (Revised and enlarged edition) Korea National Arboretum Pocheon, Kyonggido, Korea
Saitou N. , Nei M. 1987 The neighbor-joining method: a new method for reconstructing evolutionary trees. Mol. Bio. Evol. 4 406 - 425
Tamura K. , Stecher G. , Peterson D. , Filipski A. , Kumar S. 2013 MEGA6: Molecular evolutionary genetics analysis version 6.0. Mol. Biol. Evol. 30 2725 - 2729    DOI : 10.1093/molbev/mst197
Theodoridis S. , Stefanaki A. , Tezcan M. , Aki C. , Kokkini S. 2012 DNA barcoding in native plants of theLabiatae(Lamiaceae) family from Chios Island (Greece) and the adjacent Çe me-Karaburun Peninsula (Turkey). Mol. Ecol. Res. 12 620 - 633    DOI : 10.1111/j.1755-0998.2012.03129.x
White T.J. , Bruns T. , Lee S. , Taylor J. 1990 Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In: Innis, N., Gelfand, D., Sninsky, J., White, T. (Eds.). PCR Protocols: A Guide to Methods and Application. Academic Press, Inc New York, USA 315 - 322