Advanced
Analysis of the GCK and HNF-1α Gene Polymorphism in Korean Type 2 Diabetic Patients by PCR-DHPLC
Analysis of the GCK and HNF-1α Gene Polymorphism in Korean Type 2 Diabetic Patients by PCR-DHPLC
Journal of the Korean Chemical Society. 2007. Dec, 51(6): 543-548
Copyright © 2007, The Korean Chemical Society
  • Received : August 28, 2007
  • Published : December 20, 2007
Download
PDF
e-PUB
PubReader
PPT
Export by style
Article
Author
Metrics
Cited by
TagCloud
About the Authors
윤형 남
대용 박
상범 박
영창 안
상현 이
민호 조
수민 박
원철 장

Abstract
MODY는 일반적으로 제 2 형 당뇨의 특수형으로 25세 이전에 발병하며 상염색체 우성으로 유전되며 인슐린 분비장애를 특징으로 한다. GCK와 HNF-1α의 유전자 돌연변이는 제 2 형 당뇨에서 가장 큰 원인중에 하나이다. 따라서 이들 유전자다형성의 연관성을 다양한 분석 방법으로 연구할 필요성이 대두되고 있다. GCK와 HNF-1α 유전자의 exon과 exon에 근접한 intron을 실험하였고, 또한 promotor까지 PCR-DHPLC(Polymerase Chain Reaction - Denaturing High Performance Liquid Chromatography) 방법과 direct sequencing 방법을 사용하였다. 시료는 11명의 환자와 20명의 정상인에서 DNA를 추출하였고 GCK와 HNF-1α의 단일 염기다형성을 PCR-DHPLC 방법으로 확인하였다. 결과적으로 GCK 유전자에서는 1개(R135G)를 검출하였고 HNF-1α 유전자에서는 2개(I27L, S487N)를 검출하였으며 intron 8에서도 돌연변이를 검출할 수 있었다.
Keywords
서 론
당뇨병은 인슐린 결핍 또는 심한 대사성 장애로서 특징으로는 고혈당증을 나타낸다. 케톤산증을 동반한 고혈당증은 심한 전해질이상과 뇌부종으로 생명을 위협하는 문제가 될 수도 있다. 만성적으로 고혈당증이 지속되면 눈, 신장, 심장, 혈관을 포함한 많은 장기의 손상이 오는 장기적 합병증이 생긴다. 미국인의 약 5%가 당뇨병을 앓고 있으며 연간 9백억 달러의 비용이 당뇨병을 위해 사용되어지고 있다. 1
당뇨병은 2가지로 분류하며 제 1 형은 유년형 당뇨병으로서 췌장 소도 베타 세포의 자가면역성 파괴로 인한 인슐린의 절대적 결핍에 의해 발생하는 질환으로, 인슐린을 투여하지 않을 경우 당뇨병성 케톤산증(diabetic ketoacidosis, DKA)으로 사망하므로 치료를 위해서는 반드시 인슐린을 투여하여야 하는 특징을 가지고 있다. 당뇨의 제 2 형은 성인형 당뇨병으로서 췌장 소도 세포의 인슐린 분비 장애, 간 및 말초 조직의 인슐린 저항성, 대사 이상에 의한 포도당 독성 및 지질 독성 등으로 인한 인슐린의 상대적 결핍에 의해 발생하는 질환으로, 임상적으로는 제 1 형 당뇨와 다르게 인슐린 의존성이 없는 것이 특징이다. 또한 제 2 형 당뇨병 환자의 60~90%가 비만으로 인슐린 저항성이 주요 결함이고 비만하지 않은 당뇨병 환자에서는 인슐린 분비결함이 주요 병태생리로서 나타난다. 2 - 5
서구식 생활습관과 유전적으로 인해 성인기에서 발병하는 제 2형 당뇨가 청소년기에서의 발병률이 증가하고 있다. 이러한 당뇨를 MODY(Maturity onset diabetes of youth)라고 분류한다. 6 - 11
MODY는 25세 이전 발병으로서 상염색체 우성의 특징을 보인다. 그러므로 3세대간(최소 2세대)에 인슐린 분비장애를 초래한다. 이 질병의 현재까지 분류는 MODY1(HNF-4α), MODY2(Glucokinase), MODY3(HNF-1α), MODY4(IPF-1), MODY5(HNF-1β), MODY6(Neuro D1)로 6가지 유형으로 분류한다. 12 - 16
HNF-1α(hepatocyte nuclear factor-1α)는 간세포 유전자 표현에 필수적이며 항상성을 포함한다. 당뇨의 유병률은 65%의 빈도를 보이고 있다. 염색체의 12q22-qter에 위치하며 23,764 bp의 길이를 갖는다. 또한 GCK(Glucokinase)의 당뇨로서 유병률은 15%의 빈도를 보이고 있으며 염색체의 7q15.3-p15.1에 위치하며 45,174 bp의 길이를 갖는다. 17 - 25
본 연구에서는 한국인의 당뇨환자에서 HNF-1α와 glucokinase의 유전자다형성의 빈도를 새로운 분석방법인 PCR-DHPLC(denaturing high performance liquid chromatography)로 관찰하였다. 최종적으로 자동염기 서열분석기를 통해서 돌연변이 검출법의 효율성을 분석하였다.
실험 및 방법
- 시료
본 연구에서는 단국대학교병원에서 당뇨환자로 진단 받은 환자 11명과 당뇨와 상관없는 환자 20명을 대상으로 실험하였다.
- 시약 및 기기
- 시약
혈액에서 genomic DNA 추출에는 PrimePrep TM Genomic DNA Isolation Kit, Taq . polymerase는 GeNet Bio(Korea) 제품을 사용하였다. DHPLC의 이동상으로 triethylammonium acetate(TEAA)(Transgenomic, USA)와 acetonitrile(ACN)(Merck, USA)을 사용하였다.
- 기기
DNA의 증폭은 GeneAmp® PCR System 2400, 2700(Applied Biosystems, USA)을 사용하였고, PCR 증폭물 확인은 Mupid-a(Advance, Japan) 전기영동장치를 이용하였다. DHPLC는 WAVE® SYSTEM (Transgenomic, USA)을 사용해 돌연변이를 검출하였다.
- 실험 방법
- 혈액에서 genomic DNA의 추출
1.5mL 원심분리 튜브(tube)에 proteinase K(10 mg/mL) 20 μL, 혈액 200 μL와 결합 완충용액 200 μL를 넣고 5초 동안 섞은 후 60 ℃에서 10분간 반응시켰다. proteinase K와 결합 완충용액이 직접 섞이지 않도록 주의한다. 그리고 튜브에 100 μL의 isopropanol을 넣고 5초 정도 가볍게 섞어준 다음 10초 동안 원심분리 하여 뚜껑에 묻어 있는 용액을 떨어뜨려 주었다. 시료를 2 mL 수집 튜브(collection tube)에 결합시킨 컬럼(binding column)에 뚜껑이 젖지 않도록 옮겨 넣은 후, 뚜껑을 잘 닫고 8,000 rpm에서 1분간 원심분리 한 후에 컬럼을 새로운 2 mL 수집 튜브로 옮겼다. 여기에 500 μL의 세척 완충용액(washing buffer) 1을 튜브의 가장자리가 젖지 않도록 넣어주고, 뚜껑을 닫은 후에 8,000 rpm에서 1분 동안 원심분리 하였다. 원심분리 후에 컬럼을 새로운 2 mL 수집 튜브로 옮기고, 여기에 500 μL의 세척 완충용액 2를 넣어주고, 뚜껑을 닫은 후에 8,000 rpm에서 1 분 동안 원심분리 한 후에, 에탄올을 완전히 제거하기 위해 13,000 rpm에서 1분 동안 한번 더 원심분리 하였다. 컬럼을 1.5 mL 수집 튜브에 옮겨 담고, 200 μL의 용리 완충용액(elution buffer)를 넣어 주고 컬럼이 충분히 젖을 수 있도록 약 1분간 상온에서 방치해 두었다. 그리고 마지막으로 8,000 rpm에서 1분간 원심분리 하여 컬럼을 빠져나온 DNA를 수거하였다.
- 중합효소연쇄반응(PCR)
PCR primer set( 1 )을 이용하여 20 μL의 PCR 반응 용액(reaction solution)을 0.2 mL PCR 반응 시험관에 넣은 후, GeneAmp® PCR System 2400 (Applied Biosystems, USA)을 이용해서 우선 94 ℃에서 5분간 주형 DNA를 완전히 변성시킨 후(hot start) 다시 94 ℃에서 30초간 변성(denaturation), 57 ℃에서 30 초간 결합(annealing), 72 ℃에서 45초간 신장(extension) 단계를 30~35 회 반복한 후 마지막으로 72 ℃에서 5분간 신장(last extension)시켜 DNA를 증폭시켰다.
Primer used for amplification of the GCK and HNF-1α. Forward primer T7 TAATACGACTCACTATAGGG, Reverse primer T3 GTAACCCTCACTAAAGGGA
PPT Slide
Lager Image
Primer used for amplification of the GCK and HNF-1α. Forward primer T7 TAATACGACTCACTATAGGG, Reverse primer T3 GTAACCCTCACTAAAGGGA
- PCR-DHPLC 방법에 의한 단일 염기 다형성 검출
DHPLC 분석법은 DNA 돌연변이를 검출하거나 정제하는 새로운 방법으로 PCR 산물이나 RFLP 산물을 정제하지 않고 바로 분석할 수 있으며 시료 하나당 10 분이면 분석이 가능하고 분석 과정을 실시간으로 확인할 수 있기 때문에 노동력과 시간을 절약할 수 있다. 또한 모든 실험 과정이 자동화되어 있어 분석 결과의 재현성이 뛰어나다.
정제 과정을 거치지 않은 PCR 산물을 자동 시료 주입기(auto sampler)에 장착하면 syringe에 의해 컬럼으로 주입되어 적절한 이동상의 gradient로 분리하면 DNA 단편의 돌연변이 유무에 의해 단일 염기 다형성을 검출할 수 있다.
우선 컬럼의 재현성과 이동상 완충용액의 상태를 확인하기 위해서 mutant standard를 5 μL씩 3 회 주입하여 분석하였다. 다음으로 PCR 산물을 5 μL주입하여 단일 피크와 돌연변이 피크로 분리, 분석하였다. 결과의 정확성을 판단하기 위해 direct sequencing을 통해 최종 확인하였다. 이와 같은 결과는 PCRDHPLC로 분석한 결과와 동일함을 보였다.
결 과
- PCR-DHPLC 의한 단일 염기 다형성 검출
MODY의 유전자 중 빈도가 높은 GCK 유전자와 HNF-1α 유전자로 한국인의 제2형 당뇨환자와 정상인에서의 PCR-DHPLC 방법을 이용하여 유전자 다형성과 연관성을 관찰하였다.
GCK gene은 exon 1에서 1개의 돌연변이가 검출되었고 HNF-1a 유전자에서는 exon 1, exon 7에서 1개씩 그리고 intron 8 지역에서 1개의 유전자 다형성이 검출되었다( . 2 , Table 2). 환자와 정상인 모두 같은 위치에서의 돌연변이가 검출되었으며 GCK 유전자와 HNF-1α 유전자의 연관성은 연구 결과 찾을 수 없었다.
- PCR-DHPLC와 direct sequencing의 결과 분석
DHPLC 분석법은 DNA 돌연변이를 검출하거나 정제하는 새로운 방법으로 PCR 산물이나 RFLP 산물을 정제하지 않고 바로 분석할 수 있으며 시료 하나당 10분 이내에 분석이 가능하고 분석 과정을 실시간으로 확인할 수 있기 때문에 노동력과 시간을 절약할 수 있다. 또한 모든 실험 과정이 자동화되어 있어 분석 결과의 재현성이 뛰어나다. 정제 과정을 거치지 않은 PCR 산물을 자동 시료 주입기(auto sampler)에 장착하면 syringe에 의해 컬럼으로 주입되어 적절한 이동상의 gradient로 분리하면 DNA 단편의 돌연변이 유무에 의해 단일 염기 다형성을 검출할 수 있다.
우선 컬럼의 재현성과 이동상 완충용액의 상태를 확인하기 위해서 mutant standard를 5 μL씩 3번 주입하여 분석하였다( . 1 ). 다음으로 PCR 산물을 5 μL주입하여 단일 피크과 돌연변이 피크로 나오는지 확인하였다. 결과의 정확성을 판단하기 위해 direct sequencing을 통해 최종 확인하였다( . 2 ). 이와 같은 결과는 PCR-DHPLC로 분석한 결과와 동일함을 보였다.
PPT Slide
Lager Image
Chromatograms produced DHPLC analysis of mutant standard.
PPT Slide
Lager Image
Illustration of the DHPLC patterns and direct sequencing from GCK and HNF-1α genes of diabetes mellitus.
결 론
단국대학교 병원에서 당뇨환자로 진단받은 11명과 당뇨와 상관없는 환자 20명을 대상으로 genomic DNA를 추출하여 PCR 방법을 이용해 분석하고자 하는 부위의 DNA 단편을 증폭하고, 돌연변이에 기초한 PCRDHPLC로 확인하는 방법으로 GCK 유전자와 HNF-1α의 유전자 단일염기 다형성을 분석하였다. 그 결과 GCK gene은 exon 1에서 1개의 돌연변이가 검출되었고 HNF-1α 유전자에서는 exon 1에서 1개, exon 7에서 1개 그리고 intron 8 지역에서 1개의 유전자 다형성이 검출되었다.
한국인의 제 2형 당뇨환자와 정상인에서의 GCK 유전자와 HNF-1α의 유전자 다형성과 연관성을 연구하였으나 연관성은 찾아볼 수 없었고 두 유전자들의 높은 빈도의 다형성은 관찰 할 수 있었다.
또한 본 연구진은 단일 염기 분석 방법에 가장 많이 사용되는 direct sequencing 방법과 PCR-DHPLC 방법의 정확성을 비교 분석하였으며 두 실험방법의 결과가 일치함을 알 수 있었다. 최근 단일 염기 다형성 연구에 사용되어지고 있는 PCR-DHPLC 방법은 1996년에 Underhill와 Oefner에 의해서 처음으로 보고되었으며 분석할 시료인 PCR 산물을 정제하지 않고도 분석이 가능하며 그리고 그 크기가 200~1000 bp 정도에서도 95~100% 가까운 정확도를 나타내고 시료 당 분석에 걸리는 시간이 5~7분 내외로 다량의 시료를 분석하는데 매우 유용한 방법으로 알려져 있다. 25
본 연구를 통하여 당뇨 질환관 관련된 MODY family 유전자 뿐만 아니라 여러 종류의 인체 질환에서 나타나는 유전자 돌연변이 검출에 보다 빠르고 정확한 단일 염기 다형성 검출 도구로 PCR-DHPLC 분석 방법이 상당히 유용할 것으로 생각되며 향후 size detection, primer extension과 같은 새로운 단일 염기다형성 검출 방법에 DHPLC를 도입하여 겔 상에서 판단하기 힘든 하나의 염기 크기 차이도 빠르고 정확하게 검출할 수 있는 방법을 모색해야 할 것이다.
이 연구는 2005년도 단국대학교 대학연구비 지원으로 연구되었음.
References
Leahy J. L. 2005 Archives of Medical Research 36 197 -    DOI : 10.1016/j.arcmed.2005.01.003
Mitchell S. M. S. , Frayling T. M. 2002 Molecular Genetics and Metabolism 77 35 -    DOI : 10.1016/S1096-7192(02)00150-6
Froguel P. , Velho G. 1990 TEM. 10 4 -
Owen K. , Hattersley A. T. 2001 Best Practice & Research Clinical Endocrinology and Metabolism 15 39 -    DOI : 10.1053/beem.2001.0148
Ikema T. 2001 Diabetologia 45 1713 -
Kim K. A. 2003 Diabetologia 46 721 -
Boutin P. , Vasseur F. 2001 Diabetologia 44 775 -    DOI : 10.1007/s001250051687
Preuhova S. 2003 Diabetologia 46 291 -
Pigullo S. 2004 Parkinsonism & Related Disorders 10 357 -    DOI : 10.1016/j.parkreldis.2004.04.012
Frayling T. M. 1997 Diabetes 46 720 -    DOI : 10.2337/diab.46.4.720
Velho G. , Froguel P. 1998 Eur. J. Endocrinol. 138 233 -    DOI : 10.1530/eje.0.1380233
Bell G. I. 1991 Proc. Natl. Acad. Sci. U. S. A. 88 1484 -    DOI : 10.1073/pnas.88.4.1484
Yamagata K. 1996 Nature 384 458 -    DOI : 10.1038/384458a0
Froguel P. 1992 Nature 356 162 -    DOI : 10.1038/356162a0
Froguel P. 1993 New Engl. J. Med. 328 697 -    DOI : 10.1056/NEJM199303113281005
Velho G. 1997 Diabetologia 40 217 -    DOI : 10.1007/s001250050666
Vaxillaire M. 1995 Nat. Genet. 9 418 -    DOI : 10.1038/ng0495-418
Yamagata K. 1996 Nature 384 455 -    DOI : 10.1038/384455a0
Vaxillaire M. 1997 Hum. Mol. Genet. 6 583 -    DOI : 10.1093/hmg/6.4.583
Stoffers D. A. , Zinkin N. T. , Stanojevic V. , Clarke W. L. , Habener J. F. 1997 Nat. Genet. 15 106 -    DOI : 10.1038/ng0197-106
Stoffers D. A. , Ferrer J. , Clarke W. L. , Habener J. F. 1997 Nat. Genet. 17 138 -    DOI : 10.1038/ng1097-138
Horikawa Y. 1997 Nat. Genet. 17 384 -    DOI : 10.1038/ng1297-384
Chre J. C. 1998 Diabetologia 41 1017 -    DOI : 10.1007/s001250051025
Ledermann H. M. 1995 Lancet 345 648 -    DOI : 10.1016/S0140-6736(95)90548-0
Xiao W. , Oefner P. J. 2001 Human Mutation 17 439 -    DOI : 10.1002/humu.1130