Preparation of DNA Library and Affinity Column for the Analysis of RNA-RNA Interaction
Preparation of DNA Library and Affinity Column for the Analysis of RNA-RNA Interaction
Journal of the Korean Chemical Society. 2006. Jun, 50(3): 269-271
Copyright © 2006, The Korean Chemical Society
  • Received : May 03, 2006
  • Published : June 20, 2006
Export by style
Cited by
About the Authors
봉래, 조

PPT Slide
Lager Image
PPT Slide
Lager Image
PPT Slide
Lager Image
실 험
Random DNA library의 제조. 가운데 40-mer의 random sequence를 가지고 5’-쪽과 3’-쪽 양쪽으로 일정 서열을 가진 구성을 한 이중나선의 DNA library의 합성을 위해 다음과 같은 연장 반응을 실시하였다. 동량의 72-mer의 DNA primer(AGGGAGGACGATGCGG-N40-CAGACGACGAGCGGGA; N은 네 가지 누클레오티드의 동등한 혼합물을 나타낸다)와 92-mer의 tRNA primer(TGGTGCCCGGACTCGGAATCGAACCAAGGACACGGGGATTTTCAATCCCCTGCTCTACCGACTGAGCTATCCGGGGCTCCCGCTCGTCGTCTG)로부터 Taq DNA polymerase를 이용한 연장 반응으로(94 ℃에서 50초, 45 ℃에서 50초 그리고 72 ℃에서 1분) 이중가닥 DNA를 만들었다. 그리고 한편으로 72-mer의 DNA primer와 92-mer의 tRNA primer의 혼합물을 95 ℃에서 가열한 후 실온으로 서서히 cooling 시킨 다음 T4 DNA polymerase를 이용하여 37에서 30분간 반응시켜서 이중가닥 DNA를 만들었다. 이 두 가지 방법에서 합성된 이중나선 DNA library들을 native PAGE로 정제한 후 260 nm에서 흡광도를 측정하여 정량하였다.
RNA가 결합된 affinity column의 준비. RNA ligand가 결합된 affinity column을 제조하기 위하여 다음과 같이 반응시켰다. RNA ligand들로 hairpin RNA, 5S rRNA 혹은 tRNA Val 들이 사용되었다. hairpin RNA에 대한 주형 DNA에 T7 promoter를 annealing시킨 후 T7 RNA polymerase를 이용하여 hairpin RNA를 만든 다음 denaturing PAGE로 정제, 분리하였고 5S rRNA는 대장균에서 페놀로 추출하여 denaturing PAGE로 정제한 후 사용하였고 tRNA Val 는 sigma에서 구입한 후 denaturing PAGE로 정제한 후 사용하였다. 정제된 ligand RNA에 100 ul의 0.1 M K-phosphate, pH 8.0를 첨가하여 녹인 다음 50 ul의 20 mM NaIO 4 (freshly prepared)를 넣고 어두운 곳에서 2시간 동안 얼음에서 방치하였다. 3’ 말단의 리보스당이 산화된 RNA를 에탄올로 회수한 후 0.1 ml의 0.1 M K-acetate, pH 5.0에 녹여 Separose-adipic acid hydrazide resin (Pharmacia)에 첨가하여 4 ℃에서 24 시간 동안 조금씩 흔들어 주면서 coupling시킨 다음 NaBH 4 로 환원시켜 RNA ligand가 결합된 affinity column을 만들었다. coupling 반응 후 반응하지 않고 용액에서 남아있는 RNA ligand의 양은 260 nm에서 흡광도를 측정하여 정량하였다.
Tuerk G. , Gold L. 1990 Science 249 505 - 510    DOI : 10.1126/science.2200121
Ellington A. D. , Szostak J. W. 1990 Nature 346 818 - 822    DOI : 10.1038/346818a0
Binkley D. P. , Szostak J. W. 1993 Science 261 1411 -    DOI : 10.1126/science.7690155
Giver L. , Bartel D. P. , Zapp M. L. , Green M. R. , Ellington A. D. 1993 Gene 137 19 -    DOI : 10.1016/0378-1119(93)90246-Y
Famulok M. 1994 J. Am. Chem. Soc. 116 1698 -    DOI : 10.1021/ja00084a010
Geiger A. , Burgstaller P. , von der Eltz H. , Roeder A. , Famulok M. 1996 Nucleic Acids Res. 24 1029 -    DOI : 10.1093/nar/24.6.1029
Sassanfar M. , Szostak J. W. 1993 Nature 364 550 -    DOI : 10.1038/364550a0
Haller A. A. , Sarnow P. 1997 Proc. Natl. Acad. Sci. USA 94 8521 -    DOI : 10.1073/pnas.94.16.8521
Lauhon C. T. , Szostak J. W. 1995 J. Am. Chem. Soc. 117 1246 -    DOI : 10.1021/ja00109a008
Lato S. M. , Boles A. R. , Ellington A. D. 1995 Chem. Biol. 2 291 -    DOI : 10.1016/1074-5521(95)90048-9
Wallace S. T. , Schroeder R. 1998 RNA 4 112 -
Ko J. , Cho B. , Ahn J. K. , Lee Y. , Park I. 1999 Bull. Korean Chem. Soc. 20 1335 - 1339
Ko J. , Lee Y. , Park I. , Cho B. 2001 FEBS Lett. 508 300 - 304    DOI : 10.1016/S0014-5793(01)03068-X
Cho B. 2005 Bull. Korean Chem. Soc. 26 2093 - 2094    DOI : 10.5012/bkcs.2005.26.12.2093
Cho B. , Taylor D. C. , Nicholas H.B. , Schmidt F. J. 1997 Bioorg. Med. Chem. 5 1107 - 1113    DOI : 10.1016/S0968-0896(97)00046-1