Advanced
Effect of Antibiotic Down-Regulatory Gene wblA Ortholog on Antifungal Polyene Production in Rare Actinomycetes Pseudonocardia autotrophica
Effect of Antibiotic Down-Regulatory Gene wblA Ortholog on Antifungal Polyene Production in Rare Actinomycetes Pseudonocardia autotrophica
Journal of Microbiology and Biotechnology. 2014. Sep, 24(9): 1226-1231
Copyright © 2014, The Korean Society For Microbiology And Biotechnology
  • Received : June 09, 2014
  • Accepted : June 18, 2014
  • Published : September 28, 2014
Download
PDF
e-PUB
PubReader
PPT
Export by style
Article
Author
Metrics
Cited by
TagCloud
About the Authors
Hye-Jin Kim
Department of Biological Engineering, Inha University, Incheon 402-751, Republic of Korea
Min-Kyung Kim
Department of Biological Engineering, Inha University, Incheon 402-751, Republic of Korea
Young-Woo Kim
Division of Bioscience and Bioinformatics, Myongji University, Gyunggido 449-728, Republic of Korea
Eung-Soo Kim
Department of Biological Engineering, Inha University, Incheon 402-751, Republic of Korea
eungsoo@inha.ac.kr

Abstract
The rare actinomycete Pseudonocardia autotrophica was previously shown to produce a solubilityimproved toxicity-reduced novel polyene compound named N ystatin-like P seudonocardia P olyene (NPP). The low productivity of NPP in P. autotrophica implies that its biosynthetic pathway is tightly regulated. In this study, wblApau was isolated and identified as a novel negative regulatory gene for NPP production in P. autotrophica , which showed approximately 49% amino acid identity with a global antibiotic down-regulatory gene, wblA , identified from various Streptomycetes species. Although no significant difference in NPP production was observed between P. autotrophica harboring empty vector and the S. coelicolor wblA under its native promoter, approximately 12% less NPP was produced in P. autotrophica expressing the wblA gene under the strong constitutive ermE * promoter. Furthermore, disruption of the wblApau gene from P. autotrophica resulted in an approximately 80% increase in NPP productivity. These results strongly suggest that identification and inactivation of the global antibiotic down-regulatory gene wblA ortholog are a critical strategy for improving secondary metabolite overproduction in not only Streptomyces but also non- Streptomyces rare actinomycete species.
Keywords
Introduction
Polyene macrolides, a large family of polyketides with antifungal activities, are structurally characterized by polyhydroxylated macrocyclic lactones composed of 20-40 carbons with three to eight conjugated double bonds [3 , 15] . These compounds include antibiotics such as nystatin A1, amphotericins A and B, pimaricin, candicidin/FR-008, and CE-108/rimocidin [9] . Despite the recent introduction of new antifungal drugs such as next-generation azoles and echinocandins, polyene macrolides continue to be the most potent broad-spectrum antifungal agents available for clinical use, which mostly covers life-threatening fungal infections, particularly in patients who have undergone organ transplantation, received aggressive chemotherapy, or have AIDS [13] . The disadvantages of polyene macrolides are their relatively high toxicity, especially toward kidney cells, and poor distributions in tissues owing to low water solubility. In order to improve the therapeutic efficacy and reduce the toxicity of polyenes, several strategies, including combination therapy, structural modifications, and altering the physical state of the therapeutic agent in the drug delivery system, have been employed [2 , 12 , 14] .
Using a polyene cytochrome P450 hydroxylase-specific genome screening strategy, the gram-positive rare actinomycete Pseudonocardia autotrophica KCTC9441 was previously determined to contain genes related to polyene biosynthesis. This P. autotrophica gene cluster specifies the biosynthesis of nystatin-like Pseudonocardia polyene (NPP) [8] . The complete NPP structure includes an aglycone identical to nystatin with a unique di-sugar moiety, mycosamine (α1-4)- N -acetyl-glucosamine. Remarkably, when disaccharide-containing NPP was compared with mycosamine-containing nystatin, the former exhibited approximately 300-fold higher water solubility as well as 10-fold reduced hemolytic activity while retaining about 50% of its antifungal activity. These results suggest that NPP is a promising antifungal agent with improved cytotoxicity and water solubility [10] . Unfortunately, the NPP biosynthetic pathway is likely to be tightly regulated based on the very low NPP productivity observed under most P. autotrophica culture conditions [6] .
A whiB -like putative transcription factor gene named wblA was originally proposed as a global negative regulatory gene involved in polyketide biosynthesis in S. coelicolor [7 , 11] . Overexpression of wblA inhibited actinorhodin biosynthesis in S. coelicolor , and the transcript encoded by an actinorhodinspecific activator gene was reduced in wblA -overexpressing S. coelicolor , suggesting that wblA is a broadly functioning down-regulatory gene for polyketide biosynthesis in Streptomyces species [7 , 11] . Subsequently, several wblA orthologs showing more than 90% amino acid identities, such as wblAspe in S. peucetius and wblAtmc in Streptomyces sp. CK4412, were also proved to down-regulate the production of doxorubicin and tautomycetin, respectively. Here, we report that there is a less homologous wblA ortholog present in the rare actinomycete P. autotrophica , and its deletion also stimulated the intrinsically low level of NPP production. This is a first report on the identification and application of a wblA ortholog in a non- Streptomyces rare actinomycete strain.
Materials and Methods
- Bacterial Strains, Plasmids, and Media
The rare actinomycete Pseudonocardia autotrophica KCTC9441, purchased from the Korean Collection for Type Cultures, was used as an NPP-producing strain. The P. autotrophica strains were grown in ISP medium 2 (glucose 0.4%, yeast extract 0.4%, malt extract 1%, and agar 2%) at 30℃ for sporulation and YEME liquid medium for NPP production [5 , 8] . E. coli DH5α and the Streptomyces integrative plasmid ermE *pSET152 were used for the cloning and expression of target genes [5] . Methylation-deficient E. coli ET12567/pUZ8002 was used as a host for intergeneric E. coli-Streptomyces conjugations [1] . All E. coli strains were cultured at 37℃ in Luria broth or on Luria agar and supplemented with the appropriate antibiotics when needed [5] .
- Identification of wblA Ortholog from P. autotrophica Genomic Library
The P. autotrophica whole genome, with a total size of approximately 10 Mbp and containing more than 10,000 ORFs, was analyzed. In silico analysis of amino acid sequences was performed by using the National Center for Biotechnology Information (NCBI, http://www.ncbi.nlm.nih.gov ) and ClustalW2 ( http://www.ebi.ac.uk/Tools/clustalw2/index.html ). A cosmid library was prepared using the commercially available Supercos-1 cosmid system (Stratagene, USA). The cosmid library was screened by polymerase chain reaction (PCR) using forward primer 5’- GGATCCCGATGACAGCGCCGACCG -3’ and reverse primer 5’- TCTAGAAGTAGCGACGACCGGAGC-3’. PCR was performed in a final volume of 20 μl containing 0.4 μM of each primer as well as 0.25 mM of each of the four dNTPs (Roche, Switzerland), 1 μl of extracted DNA, 1 U of Ex Taq polymerase (TaKaRa, Japan) within its recommended reaction buffer, and 10% dimethyl sulfoxide (DMSO). Amplifications were performed in a Thermal Cycler (BioRad, USA) according to the following profile: 30 cycles of 60 sec at 95℃, 30 sec at 62℃, and 40 sec at 75℃. Amplified products were analyzed by electrophoresis in 1% (w/v) agarose gels and verified by sequencing using a T7 promoter primer/T3 primer in a pSupercos-1 vector.
- Inactivation of wblA Ortholog in P. autotrophica
The wblA ortholog ( wblApau ) identified from P. autotrophica was inactivated using a PCR-targeted gene disruption system [4] . An apramycin resistance gene/ ori T cassette for replacement of wblApau was amplified using the following primers: disF 5’-ACAAGAACCCCGAGCTCTTCTTCCCCGTCGGAAGCGACGATTCCGGGGATCCGTCGACC-3’ and disR 5’- AGGGCGTAGGCCAGACAGTGCTCTCGGACCGGGCAGCGATGTAGGCTGGAGCTGCTTC-3’. This cassette was introduced into E. coli BW25113/pIJ790 containing the wblApau gene, which also contained the P. autotrophica cosmid. Gene replacement in wblApau was confirmed by PCR analysis of the mutated (Δ wblApau ) cosmid. The mutated (Δ wblApau ) cosmid was introduced into P. autotrophica by conjugation from E. coli ET12567/pUZ8002. After incubation at 30℃ for 16 h, each plate was flooded with 1 ml of sterile water containing apramycin at a final concentration of 50 mg/ml and nalidixic acid at a final concentration of 25 mg/ml. Incubation continued at 30℃ until conjugants appeared. The double-crossover recombinants were first selected with apramycin resistance (apr R ) and kanamycin sensitivity (kan S ), followed by PCR confirmation.
- Cloning and Functional Expression of S. coelicolor wblA (SCO3579)
A 603 bp PCR-amplified wblA (SCO3579) included the putative promoter from S. coelicolor , a ribosome-binding site, start codon, and stop codon sequences. Otherwise, a 398 bp fragment encompassing SCO3579 with a ribosome-binding site, except the promoter, was amplified. The PCR product was cloned into the RBC T&A cloning vector, analyzed by sequencing, and ligated in the Streptomyces integrative plasmid pSET152, yielding plasmid p3579 (containing S. coelicolor promoter) and pE3579 (containing ermE * promoter).
- High-Performance Liquid Chromatography (HPLC) Assay for NPP
The P. autotrophica culture was extracted with an equal volume of butanol, followed by concentration and dissolving in methanol. For HPLC analysis of these extracts, a Shimadzu SPD M10A (Shimadzu, Japan) with a reversed-phase C-18 column (5 μm particles, 4.6 × 150 mm; Agilent) was used. The column was equilibrated with 50% solvent A (0.05 M ammonium acetate, pH 6.5) and 50% solvent B (methanol), followed by development using the following gradient:50% B (0 min), 75% B (3 min), 100% B (30 min), 50% B (33 min), and 50% B (40 min) at a flow rate of 1.0 ml/min. UV/Vis detection followed at 305 nm.
Results
- Identification of wblA ortholog wblApauin P. autotrophica
Since the whole genomic information of P. autotrophica was analyzed (unpublished data), the putative wblA ortholog could be identified through a BLASTp search using the amino acid sequence of WblA (SCO3579) from S. coelicolor with the GenoTech Prokaryotic Genome Automatic Annotation System. Using database-assisted in silico analysis, P. autotrophica genomic DNA was shown to contain the wblA ortholog gene, named wblApau . S. coelicolor WblA is believed to be functionally responsible as a WhiB family transcriptional regulator and contains highly conserved regions (α-helix and Cys-X-X-Cys motif) found in all wblA ortholog genes from Streptomyces species. Unlike previously reported Stretpomyces wblA orthologs showing more than 90% amino acid identities, the 82-amino-acid-containing wblApau showed a relatively low degree of amino acid identity (approximately 49%) with the translated products of wblA genes from S. coelicolor , S. avermitilis MA-4680, S. griseus NBRC 13350, Streptomyces CK4412, and S. peucetius ATCC27952, as well as 39% amino acid identity with the wblA gene from Corynebacterium glutamicum ATCC13032 ( Fig. 1 and Table 1 ).
PPT Slide
Lager Image
Amino acid sequence alignments between wblA ortholog (wblApau) from P. autotrophica and various Streptomyces WblAs. Conserved (asterisk) and homologous (colon) amino acids are marked. Cysteine conserved regions (gray highlight) were identified in the WblAs.
List of putative WhiB-family transcriptional regulator in various strains.
PPT Slide
Lager Image
List of putative WhiB-family transcriptional regulator in various strains.
- Functional Expression of wblA (SCO3579) in Rare Actinomycete P. autotrophica
To demonstrate that S. coelicolor wblA (SCO3579) is responsible for regulation of NPP biosynthesis, this gene was cloned from its promoter to the stop codon, using the Streptomyces integrative plasmid pSET152, after which it was introduced into the NPP-producing strain P. autotrophica . The level of NPP production was not significantly different compared with that of P. autotrophica harboring empty vector alone ( Fig. 2 ). To ascertain whether additional expression of wblA (SCO3579) is not responsible for NPP production or whether the S. coelicolor promoter is not working in P. autotrophica , wblA (SCO3579) was expressed under the strong constitutive ermE * promoter. Comparison of NPP production between wild type and wblA (SCO3579)-containing exconjugants revealed that expression of wblA (SCO3579) reduced NPP production by approximately 12% in P. autotrophica ( Fig. 2 ).
PPT Slide
Lager Image
Functional expression of the wblA (SCO3579) gene in P. autotrophica. (A) Plasmid map of the Streptomyces integrative vector for expression of wblA. (B) NPP production yield (average of triplicate) in P. autotrophica harboring the empty vector ermE*pSET152 (black); p3579, expressing wblA (SCO3579) under S. coelicolor promoter in P. autotrophica (light gray); pE3579, expressing wblA (SCO3579) under strong constitutive ermE* promoter in P. autotrophica (dark gray) was analyzed by quantitative HPLC assay.
- Stimulated NPP Production via wblApauDisruption from P. autotrophica
The wblA ortholog gene from P. autotrophica ( wblApau ) was inactivated using a PCR-targeted gene disruption system. Construction of the wblApau mutant (named P. autotrophica Δ wblApau ) was confirmed by PCR analysis. The PCR-amplified 0.3 kb band was observed in genomic DNA isolated from P. autotrophica , whereas a band of expected size (1.6 kb) was detected in P. autotrophica Δ wblApau . A 1.8 kb fragment was observed in the cosmid used for the PCR-targeted wblApau gene disruption, whereas no PCR-amplified fragments were detected in P. autotrophica wild-type or Δ wblApau strain ( Figs. 3 A and 3 B). This result suggests that the wblApau gene from P. autotrophica was inactivated by the apramycin resistance gene/ oriT cassette. No notable visual phenotypic difference was observed between P. autotrophica and P. autotrophica Δ wblApau . However, approximately 180% greater NPP production was observed from P. autotrophica Δ wblApau compared with P. autotrophica wild type over the same 3-day period in YEME production culture media ( Fig. 3 C).
PPT Slide
Lager Image
wblApau gene inactivation using a PCR-targeted gene disruption method in P. autotrophica. (A) A schematic representation of the PCR-targeted gene replacement of wblApau. (B) Gene replacement was confirmed by PCR using the primer pair #1 and 1’. (B) The absence of cosmid in P. autotrophica total chromosomal DNA was confirmed by PCR using the primer pair #2 and 2’; lane 1, P. autotrophica genomic DNA; lane 2, cosmid containing wblApau replaced with apramycin resistance gene/oriT; lanes 3~5, P. autotrophica wblApau disruption mutant strains genomic DNA. (D) P. autotrophica wild type and P. autotrophica wblApau cultured in YEME medium for 3 days. The averages of triplicates are shown with error bars.
Discussion
Natural products continue to play a highly significant role in drug discovery and development. Among them, polyene macrolides are the most potent broad-spectrum antifungals available for clinical use. Previously, the rare actinomycete P. autotrophica KCTC9441 was determined to contain genes related to polyene biosynthesis, such as N ystatin-like Pseudonocardia P olyene (NPP). However, the low level of NPP production implies that this metabolic pathway is tightly controlled by regulatory genes, such as the global down-regulatory gene wblA . Whole genome sequencing and construction of a total genomic DNA library of P. autotrophica enabled the successful isolation and inactivation of a wblA ortholog gene, wblApau , from P. autotrophica . The wblApau gene from P. autotrophica , usually considered as a non- Streptomyces rare actinomycete strain, showed a much less degree of amino acid identity with wblA genes from various Streptomyces species, implying that the biological significance of wblApau in P. autotrophica might be similar to a previously known wblA , a global antibiotic down-regulatory gene in Streptomyces . About 80% greater NPP production was observed in P. autotrophica Δ wblApau compared with P. autotrophica wild type, and approximately 12% less NPP production was identified upon expression of wblA (SCO3579) under the strong constitutive ermE * promoter. These results suggest that wblApau could be a negative regulatory gene for NPP production in P. autotrophica . Interestingly, there was no significant difference in NPP production between P. autotrophica with empty vector and P. autotrophica expressing wblA (SCO3579) under the S. coelicolor promoter. It is not clear whether or not the S. coelicolor promoter operates in P. autotrophica or NPP biosynthesis is already tightly regulated in P. autotrophica . Previously, we identified six putative NPP pathway-specific regulatory genes to be present in its biosynthetic gene cluster. Although we could not check the transcriptome profile in the wblA overexpression strain, we expected wblA overexpression regulated NPP pathway-specific regulatory genes. As a result, low NPP production was revealed upon expression of wblA under the strong constitutive ermE * promoter. In conclusion, the identification and inactivation of the global antibiotic down-regulatory gene wblA ortholog should be a critical strategy for improving secondary metabolite overproduction in not only Streptomyces but also in non- Streptomyces rare actinomycete species.
Acknowledgements
This work was supported by a grant from the Next-Generation BioGreen 21 Program (No. PJ009522), Rural Development Administration, Republic of Korea.
References
Choi S , Lee C , Hwang Y , Kinoshita H , Nihira T. 2004 Intergeneric conjugal transfer of plasmid DNA from Escherichia coli to Kitasatospora setae, a bafilomycin B1 producer. Arch. Microbiol. 181 294 - 298    DOI : 10.1007/s00203-004-0654-8
Falk R , Domb AJ , Polacheck I. 1999 A novel injectable water-soluble amphotericin B-arabinogalactan conjugate. Antimicrob. Agents Chemother. 43 1975 - 1981
Gupte M , Kulkarni P , Ganguli BN. 2002 Antifungal antibiotics. Appl. Microbiol. Biotechnol. 58 46 - 57    DOI : 10.1007/s002530100822
Gust B , Challis GL , Fowler K , Kieser T , Chater KF. 2003 PCR-targeted Streptomyces gene replacement identifies a protein domain needed for biosynthesis of the sesquiterpene soil odor geosmin. Proc. Natl. Acad. Sci. USA 100 1541 - 1546    DOI : 10.1073/pnas.0337542100
Hopwood DA. 1997 Genetic contributions to understanding polyketide synthases. Chem. Rev. 97 2465 - 2497    DOI : 10.1021/cr960034i
Jeon HJ , Seo J , Lee MJ , Han K , Kim ES. 2011 Analysis and functional expression of NPP pathway-specific regulatory genes in Pseudonocardia autotrophica. J. Ind. Microbiol. Biotechnol. 38 573 - 579    DOI : 10.1007/s10295-011-0939-2
Kang SH , Huang J , Lee HN , Hur YA , Cohen SN , Kim ES. 2007 Interspecies DNA microarray analysis identifies WblA as a pleiotropic down-regulator of antibiotic biosynthesis in Streptomyces. J. Bacteriol. 189 4315 - 4319    DOI : 10.1128/JB.01789-06
Kim BG , Lee MJ , Seo J , Hwang YB , Lee MY , Han K 2009 Identification of functionally clustered nystatin-like biosynthetic genes in a rare actinomycetes, Pseudonocardia autotrophica. J. Ind. Microbiol. Biotechnol. 36 1425 - 1434    DOI : 10.1007/s10295-009-0629-5
Kong D , Lee MJ , Lin S , Kim ES. 2013 Biosynthesis and pathway engineering of antifungal polyene macrolides in actinomycetes. J. Ind. Microbiol. Biotechnol. 40 529 - 543    DOI : 10.1007/s10295-013-1258-6
Lee MJ , Kong D , Han K , Sherman DH , Bai L , Deng Z 2012 Structural analysis and biosynthetic engineering of a solubility-improved and less-hemolytic nystatin-like polyene in Pseudonocardia autotrophica. Appl. Microbiol. Biotechnol. 95 157 - 168    DOI : 10.1007/s00253-012-3955-x
Noh JH , Kim SH , Lee HN , Lee SY , Kim ES. 2010 Isolation and genetic manipulation of the antibiotic down-regulatory gene, wblA ortholog for doxorubicin-producing Streptomyces strain improvement. Appl. Microbiol. Biotechnol. 86 1145 - 1153    DOI : 10.1007/s00253-009-2391-z
Nosanchuk JD. 2006 Current status and future of antifungal therapy for systemic mycoses. Recent Patents on Anti-Infective Drug Discovery 1 75 - 84    DOI : 10.2174/157489106775244109
Tevyashova AN , Olsufyeva EN , Solovieva SE , Printsevskaya SS , Reznikova MI , Trenin AS 2013 Structureantifungal activity relationships of polyene antibiotics of the amphotericin B group. Antimicrob. Agents Chemother. 57 3815 - 3822    DOI : 10.1128/AAC.00270-13
Torrado JJ , Espada R , Ballesteros MP , Torrado-Santiago S. 2008 Amphotericin B formulations and drug targeting. J. Pharm. Sci. 97 2405 - 2425    DOI : 10.1002/jps.21179
Zotchev SB. 2003 Polyene macrolide antibiotics and their applications in human therapy. Curr. Med. Chem. 10 211 - 223    DOI : 10.2174/0929867033368448