Advanced
A Novel Esterase from a Marine Metagenomic Library Exhibiting Salt Tolerance Ability
A Novel Esterase from a Marine Metagenomic Library Exhibiting Salt Tolerance Ability
Journal of Microbiology and Biotechnology. 2014. Jun, 24(6): 771-780
Copyright © 2014, The Korean Society For Microbiology And Biotechnology
  • Received : November 22, 2013
  • Accepted : March 11, 2014
  • Published : June 28, 2014
Download
PDF
e-PUB
PubReader
PPT
Export by style
Article
Author
Metrics
Cited by
TagCloud
About the Authors
Zeming Fang
Anhui Provincial Engineering Technology Research Center of Microorganisms and Biocatalysis, Hefei, Anhui 230601, China
Jingjing Li
Anhui Provincial Engineering Technology Research Center of Microorganisms and Biocatalysis, Hefei, Anhui 230601, China
Quan Wang
Anhui Provincial Engineering Technology Research Center of Microorganisms and Biocatalysis, Hefei, Anhui 230601, China
Wei Fang
Anhui Provincial Engineering Technology Research Center of Microorganisms and Biocatalysis, Hefei, Anhui 230601, China
Hui Peng
Anhui Provincial Engineering Technology Research Center of Microorganisms and Biocatalysis, Hefei, Anhui 230601, China
Xuecheng Zhang
Anhui Provincial Engineering Technology Research Center of Microorganisms and Biocatalysis, Hefei, Anhui 230601, China
turenzh@ahu.edu.cn
Yazhong Xiao
Anhui Provincial Engineering Technology Research Center of Microorganisms and Biocatalysis, Hefei, Anhui 230601, China
turenzh@ahu.edu.cn

Abstract
A putative lipolytic enzyme gene, named as est9x , was obtained from a marine microbial metagenome of the South China Sea. Sequence analysis showed that Est9X shares lower than 27% sequence identities with the characterized lipolytic enzymes, but possesses a catalytic triad highly conserved in lipolytic enzymes of the α/β hydrolase superfamily. By phylogenetic tree construction, Est9X was grouped into a new lipase/esterase family. To understand Est9X protein in depth, it was recombinantly expressed, purified, and biochemically characterized. Within potential hydrolytic activities, only lipase/esterase activity was detected for Est9X, confirming its identity as a lipolytic enzyme. When using p -nitrophenol esters with varying lengths of fatty acid as substrates, Est9X exhibited the highest activity to the C2 substrate, indicating it is an esterase. The optimal activity of Est9X occurred at a temperature of 65℃, and Est9X was pretty stable below the optimum temperature. Distinguished from other salttolerant esterases, Est9X’s activity was tolerant to and even promoted by as high as 4 M NaCl. Our results imply that Est9X is a unique esterase and could be a potential candidate for industrial application under extreme conditions.
Keywords
Introduction
The microbes in the oceans are a great treasure for novel genes, especially enzymes with unique properties that could provide potential benefits to many different areas such as industry, medicine, and environmental protection. However, more than 99% of the microbes in the oceans cannot be cultured [33] , leading to the full potential of this vast enzyme pool being still under-explored. Metagenomics, a culture-independent approach [9 , 38] , circumvents the problem of utilizing untapped gene resources from uncultured microorganisms [10 , 40] . It is becoming one of the best approaches to mine novel enzymes from environments, especially marine, with properties sparsely found in terrestrial homologs such as psychrotolerance, thermotolerance, and halotolerance [21] . Using this method, many novel enzymes have been obtained from the oceans, including chitinase [23] , protease [41] , oxidase [7] , oxygenase [37] , amylase [35] , xylanase [14] , polyketide synthase [5] , lysine racemase [3] , lipase, and esterase [31] .
Lipases (E.C. 3.1.1.3) and esterases (E.C. 3.1.1.1) are α/β hydrolases that catalyze the cleavage and formation of ester bonds. Traditionally, lipases catalyze the hydrolysis and synthesis of relatively long-chain triacylglycerols, whereas esterases catalyze the reactions involving shortchain triacylglycerols. Owing to their wide substrate specificity, exquisite chemoselectivity, regioselectivity, no cofactor requirement, and high stability in organic solvents [2] , lipases and esterases are currently used in a broad array of industrial applications, such as organic chemical processing, detergent formulations, the dairy industry, paper manufacture, nutrition, cosmetics, and pharmaceutical processing [15 , 16] .
Microorganisms are a rich source for lipases and esterases. Based on a comparison of their amino acid sequences and some fundamental biological properties, microbial lipases and esterases have been classified into eight families (Families I-VIII) [1] . A lipolytic enzyme usually contains a catalytic triad formed by a serine (Ser), a histidine (His), and an aspartic acid (Asp) or a glutamic acid (Glu) residues, and the Ser residue is usually conserved in the GXSXG pentapeptide motif [12] . Recently, additional families were identified on the basis of the conserved sequence motifs and biological properties of novel lipolytic enzymes discovered from metagenomic libraries of various environments, such as tidal flat sediment [25] , intertidal flat [22] , and marine surface water [4] . Moreover, many novel lipolytic enzymes with industrial potential have been obtained from diverse marine environments [4 , 8 , 18 , 22 , 24 , 29] . All these indicate that the ocean is a promising resource of novel lipolytic enzymes suitable for biotechnological applications.
Previously, we obtained a β-glucosidase-positive clone from a marine metagenomic library derived from the South China Sea [6] . Through sequencing of the inserted genomic DNA, we found an open reading frame for a protein assumed to encode a lipase/esterase (named as est9x ) using ORF Finder ( http://www.ncbi.nlm.nih.gov/gorf/gorf.html ). Based on BLASTP analysis, Est9X shares low sequence identity with lipases/esterases that have been characterized. In order to know more about this protein, in the present study, est9x was cloned, recombinantly expressed, and biochemically characterized. The results showed that Est9X was grouped into a new family of microbial lipolytic enzymes by sequence analysis, and exhibited some unique esterase properties, such as high optimum temperature and high salt tolerance, implying its potential in industrial applications.
Materials and Methods
- Sequence Analysis of Est9X
Sequence similarity search of Est9X was performed using BLASTP at NCBI ( http://www.blast.ncbi.nlm.nih.gov ) and the Lipase Engineering Database ( http://www.led.uni-stuttgart.de/ ). The module structure of the enzyme was analyzed with the Simple Modular Architecture Research Tool (SMART; http://smart.embl-heidelberg.de/ ). Multiple sequence alignment of Est9X with other lipolytic enzyme sequences was performed using ClustalX 1.8 [17] and GENEDOC ( http://www.psc.edu/biomed/genedoc ) programs, and the phylogenetic tree was constructed by the MEGA 4.1 program [39] .
- Cloning of Esterase Gene est9x
Est9x was amplified by polymerase chain reaction using the primer pair of est9xF (GCCTCC CATATG ACTAAAATATCTTTA CCAAC; Nde I digestion site underlined) and est9xR (CCGAAA CTCGAG TCTATTTGAGATTAATGCTT; Xho I digestion site underlined). The PCR product was purified and digested with Nde I and Xho I. The digested fragment was then recovered and ligated into pET22b(+) subjected to the same digestion treatment, generating the plasmid pET22b(+)- est9x with six histidine codons attached to the 3’ end of the inserted est9x . The recombinant plasmid was transformed into Escherichia coli BL21(DE3) cells, and the correctness of the construct was verified by sequencing and picked for further study.
- Expression and Purification of Recombinant Est9X
E. coli BL21(DE3) containing pET22b(+)- est9x was cultivated in 1 L of Luria-Bertani medium containing 100 μg/ml ampicillin at 37℃ until the optical density at 600 nm reached 0.6. After the culture was cooled on an ice-water bath for 10 min, protein expression was induced by 0.2 mM isopropyl-β- D -thiogalactopyranoside at 150 rpm and 16℃ for 24 h. Cells were harvested by centrifugation at 12,000 × g and 4℃ for 1 min, and then washed three times with deionized water. Cells were then resuspended in cold 20 mM Tris-HCl buffer (pH 7.9) containing 500 mM NaCl and 5 mM imidazole, disrupted by sonication, and then centrifuged at 20,000 × g for 30 min. The supernatant was applied to Ni 2+ -NTA (Novagen, Darmstadt, Germany) affinity chromatography to purify the recombinant Est9X according to the manufacturer’s instruction. The purified protein was transferred into targeted buffers by dialysis and stored at 4℃.
- Characterization of Recombinant Est9X
Protein samples were analyzed by SDS polyacrylamide gel electrophoresis (SDS-PAGE), and protein bands were stained with Coomassie Brilliant Blue R-250. The enzyme activity of Est9X was determined using p -NP esters as substrates [34] , and p -NP acetate was used as a standard substrate unless otherwise indicated. The assay mixture contained 1 mM p -NP esters (dissolved in acetonitrile), 50 mM Tris-HCl buffer (pH 8.0), and an appropriately diluted protein stock in a total volume of 1 ml. After a preincubation at 65℃ for 3 min, the reaction was started by the addition of the purified enzyme, and then incubated at 65℃ for 1 min. Then the absorbance was examined at 405 nm by a spectrophotometric method. Blank reactions were performed with every measurement under different conditions to subtract the appropriate values for nonenzymatic hydrolysis of the substrates from the results. The extinction coefficients of p -nitrophenol were also determined under each reaction condition prior to the measurements. One unit of esterase is defined as the amount of enzyme needed to release 1 μmol of p -NP per minute. All experiments were performed in triplicate and corrected by autohydrolysis of the substrates.
The substrate range and specificity of Est9X were determined by using p -NP acetate (C2), p -NP butyrate (C4), p -NP caproate (C6), p -NP caprylate (C8), p -NP decanoate (C10), p -NP laurate (C12), and p -NP myristate (C14) as the substrates in 50 mM Tris-HCl buffer (pH 8.0) at 65℃ for 1 min. The concentrations of substrates used were from 0.1 to 1 mM. Initial reaction velocities measured at various concentrations of the substrates were fitted to the Lineweaver-Burk transformation of the Michaelis-Menten equation. Kinetic analyses by curve fitting were performed with the Excel program.
The pH optimum for Est9X was measured in a pH range of 5.0 to 9.0. The esterase activity was measured with p -NP acetate as substrate. The assay was performed at 65℃ in two different buffers: 50 mM citrate-Na 2 HPO 4 buffer (pH 5.0-7.5) and 50 mM Tris-HCl buffer (pH 7.5-9.0).
The effect of temperature on the enzymatic activity of Est9X was monitored at a temperature range of 25℃ to 75℃. The esterase activity was measured with p -NP acetate as substrate. The thermostability was determined by incubating Est9X at various temperatures (25℃ to 75℃) at pH 8.0 (Tris-HCl buffer), and then the residual activities were determined following the method mentioned above at every 30 min.
The effects of various additives on the activity of Est9X were also investigated. The effects of metal ions (Mg 2+ , Zn 2+ , Ca 2+ , Mn 2+ , Na + , Cu 2+ , Ni 2+ , and Co 2+ ) were examined in a final concentration of 1, 2, and 5 mM in the reaction mixture. The chelating agent EDTA and the serine proteinase inhibitor PMSF were applied with a concentration of 1, 2, and 5 mM. The effect of salt concentration on esterase activity was investigated by adding 0.5 to 4 M of NaCl into the incubation mixture. The effects of detergents were determined for 5%, 10%, and 20% (v/v) for Tween 80, Tween 20, and Triton X-100, and 1, 2, and 5 mM for SDS. The effects of organic solvents were examined with ethyl acetate, isopropanol, alcohol, methanol, acetone, acetonitrile, and dimethyl sulfoxide at a final concentration of 5%, 10%, and 20% (v/v). All tests were performed in 50 mM Tris-HCl buffer (pH 8.0) at 65oC, and the values obtained with no additives in the reaction mixture were used as 100%.
- Nucleotide Sequence Accession Number
The nucleotide sequence data have been deposited in the GenBank database with the accession number of JX290373. The corresponding protein ID is AFR79233.
Results
- Sequence Analysis of Est9X
Sequence analysis showed that gene est9x encodes a putative protein composed of 294 amino acids, with a molecular mass of about 32 kDa without a signal peptide at the N-terminus. BLASTP search showed that the encoded protein Est9X belongs to Abhydrolase-6, with the sequence being 98% identical to a putative lipase/esterase from Glaciecola sp. HTCC2999, which was revealed by whole genome sequencing and has not been biochemically characterized. Ten homologs shared no more than 45% sequence identities with Est9X; they were also uncharacterized putative lipases/esterases. Notably, most of the homologs were derived from marine bacteria ( Table 1 ). Further BLASTP analysis for Est9X using SMART and the Lipase Engineering Database showed that Est9X shares the highest sequence identity (of 27%) with the characterized lipase from Lysinibacillus sphaericus (AAL47055).
The lipases/esterases most similar to Est9X in GenBank.
PPT Slide
Lager Image
ND: not determined.
To further evidence the lipase/esterase identity of Est9X, sequence alignment was performed for Est9X and characterized lipases/esterases. Like other lipases/esterases, Est9X contains a catalytic triad highly conserved in lipolytic enzymes of the α/β hydrolase superfamily, Ser159-Asp252-His275 ( Fig. 1 ). In addition, the sequence around Ser159 is Gly157-His158-Ser159-Ala160-Gly161, consistent with the characteristic Gly-X-Ser-X-Gly motif (where X represents any type of amino acid residue) of lipase/esterase ( Fig. 1 ). However, the active-site Ser residue in Est9X is encompassed by a unique pentapeptide motif, GHSAG, which is identical within Est9X and its homologs but slightly different from the conserved motif among the lipases/esterases in other families ( Fig. 1 ).
PPT Slide
Lager Image
Multiple sequence alignment of Est9X with representatives of other lipolytic enzyme families. Conserved residues are shaded in black (identical) and grey (similar). Residues labeled with asterisks are the catalytic triad.
To see how the Est9X was related to known lipases/esterases, the phylogenetic tree for Est9X, its closest homologs, and typical lipases/esterases from other families was constructed. Interestingly, the tree showed that Est9X clustered with its closest putative lipases/esterases, none of which has been characterized, to form a new branch, indicating that they may be lipolytic enzymes from a new esterase/lipase family ( Fig. 2 ).
PPT Slide
Lager Image
Phylogenetic relationships between Est9X and other members of lipolytic enzymes. The protein sequences of lipolytic enzymes were retrieved from GenBank. The scale bar indicates 0.2 substitutions per amino acid position.
- Production of Recombinant Est9X
To analyze the biochemical properties of Est9X, its coding gene was cloned into the plasmid pET-22b(+) and heterologously expressed in E. coli BL21(DE3). Recombinant Est9X was expressed in the inclusion body when induced at 30℃, but was partly soluble at 16℃ ( Fig. 3 ). After Ni 2+ -NTA affinity chromatography, only one protein band was shown on SDS-PAGE gel, suggesting that the purified Est9X is homogenous. Purified recombinant Est9X showed an apparent MW of 33 kDa ( Fig. 3 ), in accordance with the calculated value of 33 kDa based on the amino acid sequence with the His 6 -tag taken into account.
PPT Slide
Lager Image
SDS-PAGE for recombinantly expressed and purified Est9X. Lanes 1 and 2 show the soluble and insoluble fractions of the cell lysate, respectively; Lane 3 shows purified Est9X. The arrow shows the location of Est9X.
- Characterization of Recombinant Est9X
As described above, sequence analysis for Est9X showed that it belongs to Abhydrolase-6, which is an α/β hydrolase family containing enzymes of diverse specificity. To confirm the lipase/esterase identity of Est9X, its activities of potential hydrolases, including protease, hyperoxidase, and phosphoesterase, as well as lipase/esterase were tested. As expected, the assays detected no obvious hydrolytic activity to the substrates other than esters (data not shown).
To find the optimal substrates for Est9X, we tested its activities to various p -nitrophenyl esters with acyl chains of different lengths. Under the standard assay conditions of pH 8.0 and 65℃, Est9X preferred short-chain p -NP esters, with the maximum hydrolysis activity obtained for p -nitrophenyl acetate (C2) ( Fig. 4 ), with a K m of 0.116 ± 0.03m M and a specific activity of 61 ± 3.6 U/mg. However, Est9X displayed low activities towards the C10 and C12 substrates ( Fig. 4 ).
PPT Slide
Lager Image
Substrate specificity of Est9X. The esterase activity of Est9X to p-NP esters with varying-length chains was assayed at 65℃ in 1 ml reactions containing 50 mM Tris-HCl (pH 8.0) and 1 mM p-NP esters substrate (dissolved in acetonitrile). The value obtained with the optimum substrate C2 ester was shown as 100%.
The effects of pH and temperature on the Est9X activity were measured over a pH range of 5.0–9.0 and a temperature range of 25–75℃ with p -nitrophenyl acetate as substrate. The results showed that Est9X presented the highest activity at pH 8.0 ( Fig. 5 A), and exhibited maximum activity at 65℃, with more than 60% of it maintained at temperatures ranging from 50℃ to 75℃ ( Fig. 5 B). The half-time of Est9X was about 27 min when incubated at pH 8.0 and 65℃, but about 65% of the initial activity was retained for more than 2 h when incubated at pH 8.0 and 55℃ ( Fig. 5 C), denoting its thermostability.
PPT Slide
Lager Image
Characterization of the Est9X activity under various incubation conditions. (A) Effect of pH on the activity of Est9X. Enzyme activity was measured at pH ranging from 5 to 9 with p-NP acetate as substrate. The value obtained at pH 8.0 was shown as 100%. (B) Effect of temperature on the activity of Est9X. Enzyme activity was measured over the temperature range from 25℃ to 75℃. The value obtained at 65℃ was shown as 100%. (C) Themostability of Est9X at different temperatures.
In the presence of low concentrations of most metal ions, Est9X maintained its activity, but it was inhibited by 5 mM Zn 2+ , Cu 2+ , Ni 2+ , and especially Co 2+ ( Fig. 6 A). Addition of 5 mM EDTA had no effect on Est9X activity, indicating that Est9X is not a metalloprotein and it does not require the presence of cofactors when hydrolyzing the substrate. PMSF inhibited Est9X activity, indicating that Est9X is a Ser enzyme ( Fig. 6 A). Est9X activity was inhibited by organic solvents, with the activity decreased significantly in isopropanol, acetonitrile, alcohol, methanol, acetone, and dimethyl sulfoxide. The activity of Est9X was suppressed by all the detergents except for Triton X-100, the addition of which enhanced the activity ( Fig. 6 B).
PPT Slide
Lager Image
Effects of various additives on the activity of Est9X. Enzyme activity was measured with p-NP acetate as substrate. The enzymatic assay was performed at 65℃ in 50 mM Tris-HCl buffer (pH 8.0) with p-NP acetate as the substrate. (A) Metal ions, EDTA, and PMSF were added at the final concentration of 5 mM. (B) Organic solvents and detergents were added at the concentration of 20% (v/v) except that SDS was added at 5 mM. The value obtained with no additives in the reaction mixture was shown as 100%.
- Effect of NaCl on Est9X Activity
As Est9X is a marine derived esterase, its tolerance to salt was tested by measuring the residual activity after incubation in solution containing 0-4.0 M NaCl. The results showed that Est9X exhibited significant tolerance to high concentrations of NaCl ( Fig. 7 ). Unexpectedly, Est9X activity was even enhanced by NaCl as the concentration increased, with the activity increased to 190% in the presence of 4 M NaCl ( Fig. 7 ).
PPT Slide
Lager Image
Effect of NaCl on the activity of Est9X. Enzyme activity was measured with p-NP acetate as substrate. The value obtained in 0 M NaCl was shown as 100%.
Discussion
In this study, a putative lipolytic enzyme named Est9X was cloned from the metagenomic library of the South China Sea. Multiple sequence alignment showed that Est9X possesses a catalytic triad of Ser159-Asp252-His275, which is highly conserved in lipolytic enzymes of the α/β hydrolase superfamily ( Fig. 1 ) [4 , 8 , 13 , 18 , 19] , indicating the lipolytic enzyme identity of Est9X. On the other hand, based on the phylogenetic tree constructed with the amino acid sequences of Est9X, its most related proteins, and typical lipases/esterases from other families, we found that Est9X and its homologs were classified into a new branch ( Fig. 2 ), suggesting they may represent a new family. However, distinguished from the lipolytic enzymes from other families, Est9X and its homologs possess some distinctive characteristics in sequence, such as the unique pentapeptide motif of GHSAG around the active-site Ser residue ( Fig. 1 ). All these indicate that Est9X is a novel lipolytic enzyme from a new family.
Recently, several new families of lipolytic enzymes were identified from diverse marine metagenomic libraries of marine environments, including EstA from surface water [4] , EstF from sediment [8] , EstP1 from neritic sediments [29] , etc . In the present study, from a microbial metagenome library of the South China Sea surface water, we obtained an esterase protein, Est9X, which shares sequence identity of lower than 27% with the biochemically characterized lipolytic enzymes, and phylogenic analysis indicated that it represents a new family of lipolytic enzymes ( Fig. 2 ). Thus, our work further evidences that the marine environment is a vast pool of novel enzymes.
As Est9X constitutes a new bacterial lipolytic enzyme family with its homologs, which are obtained by whole genome sequencing and have not been characterized, the expression and characterization of Est9X provided the first experimental data for a member of this new family. Lipases, by definition, usually catalyze the hydrolysis and synthesis of relatively long-chain triacylglycerols, whereas esterases catalyze the reactions involving short-chain triacylglycerols. The enzyme Est9X identified here preferred short- and middle-chain esters (especially C2 p -NP) as substrates, indicating Est9X is an esterase rather than a lipase.
With the increasing demand of esterases under extreme conditions, the isolation of esterases with salt-tolerant ability, etc . has become a challenging task in recent years [20 , 30] . Recently, the activity of esterase PE10, found in Pelagibacterium halotolerans B2 T , was reported to be stimulated by NaCl at concentrations of 1.0 to 4.0 M, with the highest activity of 180% presented at 3 M [20] . The esterase EstKT7 from a metagenomic library was also tolerant to NaCl. Its activity was increased to 1.7-fold in the presence of 0.5 M NaCl, with an I 50 value of 3.0 M [18] . Different from the esterases mentioned above, Est9X was increasingly activated with NaCl raised from 0 to 4 M, and was enhanced by 1.9-fold in 4 M NaCl ( Fig. 7 ). This suggests that Est9X is a halotolerant enzyme with excellent NaCl tolerance. NaCl may enhance Est9X activity by promoting the affinity between the enzyme and the substrates, and facilitating the release of the catalysate from the catalytic pocket [42] . However, unlike the esterases of halophilic archaea, which actually require a high concentration of salt for function and stability [30] , Est9X was still active in the absence of NaCl. In fact, Est9X exhibited a specific activity of 61 ± 3.6 U/mg towards the C2 substrate under optimal reaction conditions without NaCl.
In conclusion, we identified the novel esterase Est9X, representing a new family of lipolytic enzymes, from a marine metagenomic library of the South China Sea. Est9X is the first experimentally characterized member of this new family, which will expand our knowledge of the enzyme diversity of bacterial lipases/esterases. In particular, Est9X displays maximum activity to the ester of extremely short chain at a high concentration of NaCl. These unusual properties make the novel esterase a candidate for specific industrial applications.
Acknowledgements
This work was funded by the National High Technology Research and Development Program of China (No. 2012AA092105), the Scientific Research Foundation for Returned Scholars, Ministry of Education of China, the Introduction Project of Academic and Technology Leaders in Anhui University (32030066), and the Innovative Research Team Program of 211 Project in Anhui University.
References
Arpigny JL , Jaeger KE 1999 Bacterial lipolytic enzymes: classification and properties. Biochem. J. 343 177 - 183    DOI : 10.1042/0264-6021:3430177
Bornscheuer UT 2002 Microbial carboxyl esterases: classification, properties and application in biocatalysis. FEMS Microbiol. Rev. 26 73 - 81    DOI : 10.1111/j.1574-6976.2002.tb00599.x
Chen IC , Lin WD , Hsu SK , Thiruvengadam V , Hsu WH 2009 Isolation and characterization of a novel lysine racemase from a soil metagenomic library. Appl. Environ. Microbiol. 75 5161 - 5166    DOI : 10.1128/AEM.00074-09
Chu X , He H , Guo C , Sun B 2008 Identification of two novel esterases from a marine metagenomic library derived from South China Sea. Appl. Microbiol. Biotechnol. 80 615 - 625    DOI : 10.1007/s00253-008-1566-3
Chung EJ , Lim HK , Kim JC , Choi GJ , Park EJ , Lee MH 2008 Forest soil metagenome gene cluster involved in antifungal activity expression in Escherichia coli. Appl. Environ. Microbiol. 74 723 - 730    DOI : 10.1128/AEM.01911-07
Fang Z , Fang W , Liu J , Hong Y , Peng H , Zhang X 2010 Cloning and characterization of a beta-glucosidase from marine microbial metagenome with excellent glucose tolerance. J. Microbiol. Biotechnol. 20 1351 - 1358    DOI : 10.4014/jmb.1003.03011
Fang Z , Li T , Wang Q , Zhang X , Peng H , Fang W 2011 A bacterial laccase from marine microbial metagenome exhibiting chloride tolerance and dye decolorization ability. Appl. Microbiol. Biotechnol. 89 1103 - 1110    DOI : 10.1007/s00253-010-2934-3
Fu C , Hu Y , Xie F , Guo H , Ashforth EJ , Polyak SW 2011 Molecular cloning and characterization of a new cold-active esterase from a deep-sea metagenomic library. Appl. Microbiol. Biotechnol. 90 961 - 970    DOI : 10.1007/s00253-010-3079-0
Handelsman J 2004 Metagenomics: application of genomics to uncultured microorganisms. Microbiol. Mol. Biol. Rev. 68 669 - 685    DOI : 10.1128/MMBR.68.4.669-685.2004
Handelsman J , Rondon MR , Brady SF , Clardy J , Goodman RM 1998 Molecular biological access to the chemistry of unknown soil microbes: a new frontier for natural products. Chem. Biol. 5 R245 - R249    DOI : 10.1016/S1074-5521(98)90108-9
Hardeman F , Sjoling S 2007 Metagenomic approach for the isolation of a novel low-temperature-active lipase from uncultured bacteria of marine sediment. FEMS Microbiol. Ecol. 59 524 - 534    DOI : 10.1111/j.1574-6941.2006.00206.x
Hess M , Katzer M , Antranikian G 2008 Extremely thermostable esterases from the thermoacidophilic euryarchaeon Picrophilus torridus. Extremophiles 12 351 - 364    DOI : 10.1007/s00792-008-0139-9
Hu Y , Fu C , Huang Y , Yin Y , Cheng G , Lei F 2010 Novel lipolytic genes from the microbial metagenomic library of the South China Sea marine sediment. FEMS Microbiol. Ecol. 72 228 - 237    DOI : 10.1111/j.1574-6941.2010.00851.x
Hu Y , Zhang G , Li A , Chen J , Ma L 2008 Cloning and enzymatic characterization of a xylanase gene from a soilderived metagenomic library with an efficient approach. Appl. Microbiol. Biotechnol. 80 823 - 830    DOI : 10.1007/s00253-008-1636-6
Jaeger KE , Dijkstra BW , Reetz MT 1999 Bacterial biocatalysts: molecular biology, three-dimensional structures, and biotechnological applications of lipases. Annu. Rev. Microbiol. 53 315 - 351    DOI : 10.1146/annurev.micro.53.1.315
Jaeger KE , Reetz MT 1998 Microbial lipases form versatile tools for biotechnology. Trends Biotechnol. 16 396 - 403    DOI : 10.1016/S0167-7799(98)01195-0
Jeanmougin F , Thompson JD , Gouy M , Higgins DG , Gibson TJ 1998 Multiple sequence alignment with Clustal X. Trends Biochem. Sci. 23 403 - 405    DOI : 10.1016/S0968-0004(98)01285-7
Jeon JH , Lee HS , Kim JT , Kim SJ , Choi SH , Kang SG , Lee JH 2012 Identification of a new subfamily of salt-tolerant esterases from a metagenomic library of tidal flat sediment. Appl. Microbiol. Biotechnol. 93 623 - 631    DOI : 10.1007/s00253-011-3433-x
Jeon JH , Kim JT , Lee HS , Kim SJ , Kang SG , Choi SH , Lee JH 2011 Novel lipolytic enzymes identified from metagenomic library of deep-sea sediment. Evid. Based Complement. Alternat. Med. 2011 271419 -
Jiang X , Huo Y , Cheng H , Zhang X , Zhu X , Wu M 2012 Cloning, expression and characterization of a halotolerant esterase from a marine bacterium Pelagibacterium halotolerans B2T. Extremophiles 16 427 - 435    DOI : 10.1007/s00792-012-0442-3
Kennedy J , Marchesi JR , Dobson AD 2008 Marine metagenomics: strategies for the discovery of novel enzymes with biotechnological applications from marine environments. Microb. Cell Fact. 7 27 -    DOI : 10.1186/1475-2859-7-27
Kim EY , Oh KH , Lee MH , Kang CH , Oh TK , Yoon JH 2009 Novel cold-adapted alkaline lipase from an intertidal flat metagenome and proposal for a new family of bacterial lipases. Appl. Environ. Microbiol. 75 257 - 260    DOI : 10.1128/AEM.01400-08
LeCleir GR , Buchan A , Maurer J , Moran MA , Hollibaugh JT 2007 Comparison of chitinolytic enzymes from an alkaline, hypersaline lake and an estuary. Environ. Microbiol. 9 197 - 205    DOI : 10.1111/j.1462-2920.2006.01128.x
Lee MH , Hong KS , Malhotra S , Park JH , Hwang EC , Choi HK 2010 A new esterase EstD2 isolated from plant rhizosphere soil metagenome. Appl. Microbiol. Biotechnol. 88 1125 - 1134    DOI : 10.1007/s00253-010-2729-6
Lee MH , Lee CH , Oh TK , Song JK , Yoon JH 2006 Isolation and characterization of a novel lipase from a metagenomic library of tidal flat sediments: evidence for a new family of bacterial lipases. Appl. Environ. Microbiol. 72 7406 - 7409    DOI : 10.1128/AEM.01157-06
Lorenz P , Eck J 2005 Metagenomics and industrial applications. Nat. Rev. Microbiol. 3 510 - 516    DOI : 10.1038/nrmicro1161
Panda T , Gowrishankar BS 2005 Production and applications of esterases. Appl. Microbiol. Biotechnol. 67 160 - 169    DOI : 10.1007/s00253-004-1840-y
Park HJ , Jeon JH , Kang SG , Lee JH , Lee SA , Kim HK 2007 Functional expression and refolding of new alkaline esterase, EM2L8 from deep-sea sediment metagenome. Protein Expr. Purif. 52 340 - 347    DOI : 10.1016/j.pep.2006.10.010
Peng Q , Zhang X , Shang M , Wang X , Wang G , Li B 2011 A novel esterase gene cloned from a metagenomic library from neritic sediments of the South China Sea. Microb. Cell Fact. 10 95 -    DOI : 10.1186/1475-2859-10-95
Rao L , Zhao X , Pan F , Li Y , Xue Y , Ma Y , Lu JR 2009 Solution behavior and activity of a halophilic esterase under high salt concentration. PLoS ONE 4 e6980 -    DOI : 10.1371/journal.pone.0006980
Rhee JK , Ahn DG , Kim YG , Oh JW 2005 New thermophilic and thermostable esterase with sequence similarity to the hormone-sensitive lipase family, cloned from a metagenomic library. Appl. Environ. Microbiol. 71 817 - 825    DOI : 10.1128/AEM.71.2.817-825.2005
Saerens K , Descamps D , Dewettinck K 2008 Release of short chain fatty acids from cream lipids by commercial lipases and esterases. Biotechnol. Lett. 30 311 - 315    DOI : 10.1007/s10529-007-9541-0
Schloss PD , Handelsman J 2003 Biotechnological prospects from metagenomics. Curr. Opin. Biotechnol. 14 303 - 310    DOI : 10.1016/S0958-1669(03)00067-3
Schmidt-Dannert C , Sztajer H , Stocklein W , Menge U , Schmid RD 1994 Screening, purification and properties of a thermophilic lipase from Bacillus thermocatenulatus. Biochim. Biophys. Acta 1214 43 - 53    DOI : 10.1016/0005-2760(94)90008-6
Sharma S , Khan FG , Qazi GN 2010 Molecular cloning and characterization of amylase from soil metagenomic library derived from Northwestern Himalayas. Appl. Microbiol. Biotechnol. 86 1821 - 1828    DOI : 10.1007/s00253-009-2404-y
Sheridan PP , Panasik N , Coombs JM , Brenchley JE 2000 Approaches for deciphering the structural basis of low temperature enzyme activity. Biochim. Biophys. Acta 1543 417 - 433    DOI : 10.1016/S0167-4838(00)00237-5
Singh A , Singh Chauhan N , Thulasiram HV , Taneja V , Sharma R 2010 Identification of two flavin monooxygenases from an effluent treatment plant sludge metagenomic library. Bioresour. Technol. 101 8481 - 8484    DOI : 10.1016/j.biortech.2010.06.025
Sleator RD , Shortall C , Hill C 2008 Metagenomics. Lett. Appl. Microbiol. 47 361 - 366    DOI : 10.1111/j.1472-765X.2008.02444.x
Tamura K , Dudley J , Nei M , Kumar S 2007 MEGA4: Molecular Evolutionary Genetics Analysis (MEGA) software version 4.0. Mol. Biol. Evol. 24 1596 - 1599    DOI : 10.1093/molbev/msm092
Voget S , Leggewie C , Uesbeck A , Raasch C , Jaeger KE , Streit WR 2003 Prospecting for novel biocatalysts in a soil metagenome. Appl. Environ. Microbiol. 69 6235 - 6242    DOI : 10.1128/AEM.69.10.6235-6242.2003
Waschkowitz T , Rockstroh S , Daniel R 2009 Isolation and characterization of metalloproteases with a novel domain structure by construction and screening of metagenomic libraries. Appl. Environ. Microbiol. 75 2506 - 2516    DOI : 10.1128/AEM.02136-08
Wu GJ , Zhang S , Zhang HJ , Zhan SS , Liu ZD 2013 A novel esterase from a psychrotrophic bacterium Psychrobacter celer 3Pb1 showed cold-adaptation and salt-tolerance. J. Mol. Catal. B Enzym. 98 119 - 126    DOI : 10.1016/j.molcatb.2013.10.012
Zhang YJ , Zhang XY , Mi ZH , Chen CX , Gao ZM , Chen XL 2011 Glaciecola arctica sp. nov., isolated from Arctic marine sediment. Int. J. Syst. Evol. Microbiol. 61 2338 - 2341    DOI : 10.1099/ijs.0.027326-0