Different Immune Regulatory Potential of Lactobacillus plantarum and Lactobacillus sakei Isolated from Kimchi
Different Immune Regulatory Potential of Lactobacillus plantarum and Lactobacillus sakei Isolated from Kimchi
Journal of Microbiology and Biotechnology. 2014. Dec, 24(12): 1629-1635
Copyright © 2014, The Korean Society For Microbiology And Biotechnology
  • Received : June 23, 2014
  • Accepted : August 04, 2014
  • Published : December 28, 2014
Export by style
Cited by
About the Authors
Yi-Fan, Hong
Skin Biotechnology Center, Kyung Hee University, Yongin 449-701, Republic of Korea
Hangeun, Kim
RNA Inc., #308 College of Life Science, Kyung Hee University, Yongin 449-701, Republic of Korea
Hye Rim, Kim
Graduate School of Biotechnology and Institute of Life Science and Resources, Kyung Hee University, Yongin 446-701, Republic of Korea
Min Geun, Gim
Graduate School of Biotechnology and Institute of Life Science and Resources, Kyung Hee University, Yongin 446-701, Republic of Korea
Dae Kyun, Chung
RNA Inc., #308 College of Life Science, Kyung Hee University, Yongin 449-701, Republic of Korea

It is known that lactic acid bacteria (LAB) have many beneficial health effects, including antioxidative activity and immune regulation. In this study, the immune regulatory effects of Lactobacillus sakei and Lactobacillus plantarum , which are found in different types of kimchi , were evaluated. L. sakei and its lipoteichoic acid (LTA) have greater immune stimulating potential in IL-12, IFN-γ, and TNF-α production as compared with L. plantarum in an in vitro condition. On the other hand, L. plantarum is assumed to repress the Th1 immune response in murine experiments. After being injected with LPS, L. plantarum -fed mice maintained a healthier state, and the level of TNF-α in their blood was lower than in other bacterial strainfed mice and in the LPS-only control mice. Additionally, IL-12 production was significantly decreased and the production of IL-4 was greatly increased in the splenocytes from L. plantarum -fed mice. Further experiments revealed that the pre-injection of purified LTA from L. plantarum (pLTA), L. sakei (sLTA), and S. aureus (aLTA) decreased TNF-α and IL-4 production in LPS-injected mice. Mouse IL-12, however, was significantly increased by aLTA pre-injection. In conclusion, the L. sakei and L. plantarum strains have immune regulation effects, but the effects differ in cytokine production and the regulatory effects of the Th1/Th2 immune response.
Numerous reports have demonstrated the beneficial effects of lactic acid bacteria (LAB). Such effects include anti-oxidative effects, antitumor effects, maintenance of the normal flora of the digestive tract, prevention of enteritis, and regulation of immune responses, among others [26] . Currently, the effects of LAB on the immune system have been well studied. Most of the immune responses induced by LAB are innate immune responses that execute immune reactions before the adapted immune response is activated. Innate immune responses transmit various signals that instruct the adapted immune system to activate [22] . Probiotics are defined as “living microorganisms, which on ingestion in certain numbers, exert health benefits beyond inherent basic nutrition” [15] . LAB, including members of the Lactobacillus genus, are members of the commensal microorganisms of the gastrointestinal tract of humans and mammals and are generally recognized as probiotics [9 , 17] .
It is widely believed that intestinal LAB play an important role in promoting the health of the host, including the modulation of immune responses [1 , 13 , 15] . One potential function of LAB is their involvement in the development and maintenance of homeostasis in the intestine-associated immune system [1 , 31] . It has been shown that peptidoglycan and other cell wall components of LAB may play a significant role in stimulating immunocompetent cells in the intestinal tract [1 , 2 , 7 , 15] . Intestinal LAB, including various species of Lactobacillus , interact regularly with intestinal cells, which include antigen-presenting cells and intestinal epithelial cells [16 , 27 , 32] . It has been reported that lactobacilli may moderate allergic reactions by maintaining the balance between Th1 and Th2 responses [1 , 11 , 23] . This balance is thought to be maintained by specialized subsets of T-regulatory (Treg) cells that produce suppressive cytokines, such as interleukin (IL)-10 and transforming growth factor (TGF)-β [8 , 24] .
To date, most studies have focused on the immunomodulatory effects of viable LAB; however, we investigated those of heat-killed LAB in this study. Heat-killed LAB have the advantages of allowing a longer product shelf life and easier storage and transport. Studies have demonstrated that LAB can effectively stimulate the production of IL-12 and interferon (IFN)-γ and modulate immune responses in mice and humans [23 , 30] . Many bacterial strains have been discovered, but most bacterial strains are isolated from milk and industrial meat products. There are very few probiotic bacterial strains isolated from vegetable matter. The traditional Korean fermented food kimchi is rich in vegetable matter and probiotic bacterial strains [20] . Several LAB strains have been isolated from kimchi , but there are few reports investigating their functional effects [4 , 21] . Our study focused on the immune characteristics of two Lactobacillus strains that inhabit kimchi , Lactobacillus sakei and L. plantarum . L. sakei was isolated from a commercial Korean kimchi during the course of this experiment. L. plantarum was discovered during our previous work on the anti-inflammatory potency of L. plantarum LTA [18 , 19] . This study focused on the influence of L. plantarum and L. sakei in murine models under in vivo conditions.
Materials and Methods
- Bacterial Strains and Culture Conditions
L. sakei was isolated from the Korean traditional food kimchi , and the strain was confirmed by 16S rRNA/16S-23S rRNA IRS gene sequencing. The following primers (Bioneer, Korea) were used to amplify the 16S rRNA and 16S-23S rRNA IRS genes: 16s forward (AGTTGATCCTGGCTC), 16S reverse (ACCTTGTTA CGACTT) [28] ; and IRS forward (TGCGGCTGGATCACCTCCTT), IRS reverse (GGTTCTTTTCACCTTTCCCTC) [6] . The resultant PCR products were sequenced (Bionics, Korea) for phylogenetic analysis. L. sakei , L. rhamnosus GG (KCTC 5033), and L. plantarum (ACTCBAA-793) were cultured in Man, Rogosa, and Sharpe (MRS) broth (Difco, USA). Staphylococcus aureus (KCTC 1621) was cultured in Brain Heart Infusion (BHI) broth (Difco). The cells were harvested by centrifugation at 5,000 × g for 10 min and then washed three times with sterile saline solution to purify lipoteichoic acid (LTA), which was then freeze dried.
- Purification of LTA
LTA was prepared from the Lactobacillus strains and Staphylococcus aureus using the methods detailed by Han et al. [12] . Harvested cells were broken up by sonication. The sonicated cells were extracted with n -butanol, and LTA was first purified using hydrophobic interaction chromatography with an Octyl-Sepharose CL-4B column. For further purification, DEAE Sepharose ionexchange column chromatography was performed. Purified LTAs were stored by freeze-drying.
- Animals
Female 7- to 8-week-old BALB/c mice were bred and raised under conventional conditions at the Kyung Hee University Biocenter. They were housed in individual cages at 23 ± 3℃, and offered feed and water ad libitum . The Institutional Animal Care and Use Committee of Kyung Hee University approved this study.
- Material Administration to Mice
Mice were each fed freeze-dried heat-killed bacterial cells (5 mg/day with 1% skim milk), which were dissolved in 200 µl of sterilized water for 2 weeks before the experiments were performed. Mice were injected with 10 mg/kg LPS (Sigma, USA) and their sera were collected 24 h after LPS injection. Mice were injected with 20 µg of ovalbumin (OVA) dissolved 5:5 in phosphate-buffered saline (PBS) and an alum solution (Sigma), 1 week after the sera were collected to detect and measure levels of immunog lobulin. The mice were sacrificed to obtain their splenocytes after 2 weeks of treatment.
- Preparation of Spleen Cell Suspensions
Spleens were removed aseptically from the mice and placed individually into 5.0 ml of complete RPMI-1640 medium. Single cell suspensions were prepared by chopping the spleens into small pieces with sterile scissors and then forcing the spleen tissue up and down through a 1.0 ml syringe. The resulting suspension was then transferred to a tube containing 5.0 ml of complete RPMI-1640 and centrifuged at 4℃ at 1,500 rpm for 10 min. The cell pellet was resuspended in 0.8 ml of ammonium-chloridepotassium lysis buffer and incubated for 1 min. After washing twice in complete RPMI-1640, the cells were adjusted to a final concentration of 2 × 10 6 cells/ml in complete RPMI-1640.
- Enzyme-Linked Immunosorbent Assay (ELISA)
TNF-α, IL-12, and IL-4 were measured using ELISA kits (R&D Systems, MN, USA) and immunoglobulins were also detected using ELISA kits (BD, USA). To measure OVA-specific IgE, we used the method detailed by Sato et al. [29] . Standard serum for comparison was obtained from mice immunized three times with 20 µg of OVA and the alum solution. Standard serum was considered to contain 100% of each immunoglobulin.
- Statistical Analysis
All experiments were performed at least three times. The data shown are representative results of the means ± SD of triplicate experiments. Differences were considered statistically significant when the p value was <0.05.
- Cytokine Production in Splenocytes Due to Lactobacillus Strains
To analyze the role of Lactobacillus strains isolated from kimchi , mouse splenocytes were treated with heat-killed L. sakei and L. plantarum . We observed that both L. sakei and L. plantarum induced the secretion of proinflammatory cytokines. Mouse IL-12 was significantly increased by L. sakei (1 × 10 6 and 1 × 10 7 cells), whereas L. plantarum moderately increased these levels ( Fig. 1 A). Both L. sakei and L. plantarum also increased mouse IFN-γ, and the induction of IFN-γ by L. sakei was much higher than that by L. plantarum ( Fig. 1 B). Mouse TNF-α was increased by both L. sakei and L. plantarum up to 1 × 10 7 cells, but it was slightly decreased by 1 × 10 8 L. plantarum ( Fig. 1 C). These data indicate that the Lactobacillus strains isolated from kimchi have a different immune regulatory effect on proinflammatory cytokine expression.
PPT Slide
Lager Image
Potential for different cytokine production by bacterial strains in mouse splenocytes. Mouse splenocytes were obtained from ovalbumin (20 µg/mouse in alum)-immunized mice (two times in 14 days). Splenocytes were treated with the indicated amount of heat-killed bacteria. Culture supernatants were collected, and IL-12 (A), IFN-γ (B), and TNF-α (C) levels were determined using ELISA. The data are shown as the mean ± SD for the three groups. Ctr indicates the untreated control. Statistical p values were determined using a two-tailed t-test: *p < 0.05; **p < 0.01; ***p < 0.001 compared with untreated cells.
- Immune Response of Bacterial Strains In Vivo
To investigate the effects of the bacterial strains in vivo , we fed freeze-dried bacteria to mice. Mice were orally administered with freeze-dried heat-killed bacteria for 14 days, and LPS was intraperitoneally injected into the mice of each group. Blood was collected 24 h after LPS injection, and the levels of TNF-α were measured. The TNF-α levels of the blood from L. sakei - and L. plantarum -fed mice were significantly lower as compared with the LPS-only-injected control group and the other bacterial strain groups ( Fig. 2 A). Mice in the L. plantarum -fed group also maintained the best health conditions compared with the other bacterial strain groups and the control group during the study. This result suggests that L. sakei and L. plantarum can inhibit excessive inflammation caused by pathogen infection. To detect antigen-specific IgE, we fed mice for 14 days before OVA immunization. Seven days after immunization, blood was collected and the levels of anti-OVA IgE were measured. Blood from the L. plantarum -fed group showed slightly increased anti-OVA IgE levels as compared with the control group and the other bacterial strain groups ( Fig. 2 B), indicating that heat-killed Lactobacillus strains and S. aureus do not affect OVA-specific IgE expression.
PPT Slide
Lager Image
Effect of L. plantarum an mouse TNF-α and IgE production. (A) L. plantarum decreases TNF-α production in LPS-injected mice. Mice were orally administered 1 × 107 freeze-dried heat-killed bacteria in 1% skim milk (5 mg/day) for 2 weeks before LPS injection (10 mg/kg). Blood was collected 24 h after LPS injection and TNF-α levels were determined by ELISA. (B) L. plantarum increases OVA-specific IgE production in OVA immunized mice. Mice were orally administered with 1 × 107 freeze-dried heat-killed bacteria in 1% skim milk (5 mg/day) for 2 weeks before ovalbumin (OVA) (20 µg/mouse in alum) immunization. Blood was collected 7 days after OVA immunization and OVA-specific IgE levels were determined by ELISA. The control blood (CB) was obtained from mice that were immunized three times with OVA. CB levels were considered 100%. The data are represented as the mean ± SD from five mice per group. Statistical p values were determined using a two-tailed t-test: *p < 0.05 compared with the control. Ctl, control; SA, Staphylococcus aureus; LS, Lactobacillus sakei; LG, Lactobacillus rhamnosus GG; LP, Lactobacillus plantarum.
- Cytokine Balance Shifting by Bacterial Strains in LPS-Stimulated Splenocytes
To clarify the different immune responses in vitro , we obtained mouse splenocytes from OVA-immunized mice (two times in 14 days), which were orally administered with freeze-dried heat-killed bacteria for 2 weeks before the first OVA immunization. After extraction of the splenocytes, the cells were treated with OVA and LPS for 48 h and the culture supernatants were collected. OVA and LPS-mediated TNF-α and IL-12 production levels in the splenocytes of L. plantarum -fed mice were significantly decreased as compared with the other strains ( Figs. 3 A and 3 B). On the other hand, IL-4 production from the splenocytes of L. plantarum -fed mice was significantly increased ( Fig. 3 C). These results suggest that orally administered L. plantarum can inhibit the endotoxinmediated excessive Th1 response and it may drive the Th2 immune response.
PPT Slide
Lager Image
Splenocytes from L. plantarum-administered mice decreased TNF-α and IL-12 production and increased IL-4 production. Mice were orally administered freeze-dried heat-killed bacteria in 1% skim milk (5 mg/day) for 2 weeks before ovalbumin (OVA) (20 µg/mouse in alum, two times in 14 days) immunization. Mouse splenocytes were obtained from OVA-immunized mice and immunized with OVA (5.0 µg/ml) and LPS. Culture supernatants were collected 48 h after LPS treatment and the TNF-α (A), IL-12 (B), and IL-4 (C) levels were determined via ELISA. The data are represented as the mean ± SD from three groups. Statistical p values were determined using a twotailed t-test: *p < 0.05; **p < 0.01 compared with untreated control cells. Ctl, control; SA, Staphylococcus aureus; LS, Lactobacillus sakei; LG, Lactobacillus rhamnosus GG; LP, Lactobacillus plantarum.
- Effect of LTAs on Cytokine Production
To identify the immune regulatory effects of bacteria cell wall components, we purified lipoteichoic acid (LTA) from L. sakei (sLTA) and L. plantarum (pLTA). LTA isolated from S. aureus was used as a control (aLTA). Protein and endotoxin contamination of the purified LTA were examined by silver staining ( Fig. 4 A) and LAL-testing ( Table 1 ), respectively. The priming treatment of sLTA, pLTA, and aLTA followed by LPS retreatment in splenocytes isolated from OVA-immunized mice significantly decreased mouse TNF-α ( Fig. 4 B) and IL-4 ( Fig. 4 C) production. Interestingly, unlike heat-killed bacteria, the Lactobacillus LTAs inhibited IL-4 production. The discrepancy of these two experiments may be caused by the dosage of material used. Approximately, 100 µg/ml LTA corresponds to 6 × 10 10 bacteria. However, IL-12 production was not affected by pLTA and sLTA. High aLTA doses significantly increased IL-12 production ( Fig. 4 D). Together, LTA isolated from Lactobacillus strains had an inhibitory effect on endotoxin-mediated inflammation, which may suggest that LTA downregulates both the Th1 and Th2 responses.
PPT Slide
Lager Image
The different cytokine production potential by LTA priming treatment in mouse splenocytes. (A) LTAs were prepared as described in the Materials and Methods. The contamination of purified LTAs was determined by silver staining. The splenocytes were obtained from ovalbumin (20 µg/mouse in alum)-immunized mice (two times in 14 days). LTAs were pretreated at the indicated concentrations in mouse splenocytes (1 × 106 cells/ml) for 24 h, and then 0.1 µg/ml LPS was retreated for 24 h. Culture supernatants were collected and the TNF-α (B), IL-14 (C), and IL-12 (D) levels were determined by ELISA. Statistical p values were determined using a two-tailed t-test: *p < 0.05; **p < 0.01; ***p < 0.001 compared with LTA-untreated control cells.
LAL test to confirm endotoxin contamination in LTAs.
PPT Slide
Lager Image
LAL, Limulus amebocyte lysate; LTAs were isolated from S. aureus, L. sakei, L. rhamnosus GG, and L. plantarum.
Numerous reports have suggested that LAB influence the immune system and have the potential to promote beneficial effects in some immune disorders [14] . Our study focused on the immune characteristics of two Lactobacillus strains that were isolated from kimchi . In the present study, L. sakei showed greater immune-inducing potential than the other bacterial strains under in vitro conditions. The immune-inducing potential of L. plantarum , however, was very low. Thus, our results suggest that L. sakei could be a powerful candidate for an immunestimulating LAB probiotic. It is known that LPS is a powerful immune-stimulating material [25] . It is supposed that the LTA of L. sakei is an immune booster like LPS, since sLTA dramatically increased pro-inflammatory cytokine production (data not shown). More investigation is needed characteristics of L. sakei and L. sakei LTA were studied only in in vitro conditions; some reports state that comprehensive in vivo results are needed to clarify the present findings. We also focused on the characteristics of L. plantarum that are involved in the immune stimulating potential that showed no effects compared with the other LAB.
To investigate the differences in immune reactions under in vivo conditions between each strain that showed significantly different reactions under in vitro conditions, BALB/c mice were orally administered with freeze-dried heat-killed bacteria. Two weeks later, mice were injected with OVA and LPS to induce sepsis. The L. sakei - and L. plantarum -fed mice displayed reduced septic shock effects in the LPS-injected condition as compared with those of the other bacterial strains and the control. Further study to detect blood immunoglobulin levels in the OVA-challenged mice revealed that L. plantarum represses the Th1 immune response. The levels of total OVA-specific IgG and total IgE were not changed significantly (data not shown) in L. plantarum -fed mice, but the OVA-specific IgE level was slightly increased. This result may represent the increase in the Th2 immune response, which represses Th1 polarization. In previous studies, it was reported that treatment with L. plantarum increased IL-12 levels in splenocytes [10] . However, heat-killed L. plantarum -mediated mouse IL-12 blood levels were moderately increased in the current study. The differences between these two experiments could have been due to the direct treatment of bacteria to splenocytes, which may increase high levels of cytokine production, whereas indirect treatment via oral administration may not cause the same effect. In the present study, we also noticed that the influence of the effects of bacterial strains on the immune response was entirely consistent in both the in vivo and in vitro conditions.
Numerous reports have considered the influence of LAB on the Th1 and Th2 immune responses [3] . The current study demonstrates a repression of the Th1 immune response, and the Th1 immune response is considered to induce inflammatory reactions. It could, therefore, be assumed that L. plantarum shows potential for inducing anti-inflammatory effects. It is known that excessive inflammation induces various immune disorders [5] . L. plantarum is supposed to have beneficial influences on inflammatory disorders, and there is some possibility of using L. plantarum as a therapeutic bacterial strain. Previously, we reported that L. plantarum and its LTA have potential as a medical treatment material for septic shock conditions in an in vitro environment [18 , 19] . There must, therefore, be more studies investigating the effects of L. plantarum on excessive inflammatory conditions.
In conclusion, we focused on two LAB strains, L. sakei and L. plantarum , which were isolated from kimchi . We characterized the immune stimulating effects of L. sakei in vitro and the Th1 immune response-repressing influence of L. plantarum . These two strains are predicted to have the potential to induce beneficial health effects. However, larger numbers of LAB strains remain to be examined in kimchi , and further studies are needed to discover their characteristics.
This work was supported by a grant from Kyung Hee University in 2011 (KHU-20110263).
Adlerberth I , Ahrne S , Johansson ML , Molin G , Hanson LA , Wold AE 1996 A mannose-specific adherence mechanism inLactobacillus plantarumconferring binding to the human colonic cell line HT-29. Appl. Environ. Microbiol. 62 2244 - 2251
Adlerberth I , Hanson LA , Svanborg C , Svennerholm AM , Nordgren S , Wold AE 1995 Adhesins ofEscherichia coliassociated with extra-intestinal pathogenicity confer binding to colonic epithelial cells. Microb. Pathog. 18 373 - 385    DOI : 10.1006/mpat.1995.0034
Borchers AT , Keen CL , Gershwin ME 2002 The influence of yogurt/Lactobacilluson the innate and acquired immune response. Clin. Rev. Allergy Immunol. 22 207 - 230    DOI : 10.1007/s12016-002-0009-7
Cho YR , Chang JY , Chang HC 2007 Production of gammaaminobutyric acid (GABA) byLactobacillus buchneriisolated fromkimchiand its neuroprotective effect on neuronal cells. J. Microbiol. Biotechnol. 17 104 - 109
D'Elios M , Del Prete G 1998 Th1/Th2 balance in human disease. Transplant Proc. 30 2373 - 2377    DOI : 10.1016/S0041-1345(98)00659-9
de Oliveira VM , Manfio GP , da Costa Coutinho HL , Keijzer-Wolters AC , van Elsas JD 2006 A ribosomal RNA gene intergenic spacer based PCR and DGGE fingerprinting method for the analysis of specific rhizobial communities in soil. J. Microbiol. Methods 64 366 - 379    DOI : 10.1016/j.mimet.2005.05.015
Duguid JP 1959 Fimbriae and adhesive properties inKlebsiellastrains. J. Gen. Microbiol. 21 271 - 286    DOI : 10.1099/00221287-21-1-271
Engvall E , Perlmann P 1972 Enzyme-linked immunosorbent assay, ELISA. III. Quantitation of specific antibodies by enzyme-labeled anti-immunoglobulin in antigen-coated tubes. J. Immunol. 109 129 - 135
Finegold SM , Attebery HR , Sutter VL 1974 Effect of diet on human faecal flora: comparison of Japanese and American diets. Am. J. Clin. Nutr. 27 1546 - 1569
Grangette C , Nutten S , Palumbo E , Morath S , Hermann C , Dewulf J 2005 Enhanced antiinflammatory capacity of aLactobacillus plantarummutant synthesizing modified teichoic acids. Proc. Natl. Acad. Sci. USA 102 10321 - 10326    DOI : 10.1073/pnas.0504084102
Gustafsson BE 1959 Light weight stainless steel systems for rearing germfree animals. Ann. NY Acad. Sci. 78 17 - 28    DOI : 10.1111/j.1749-6632.1959.tb53092.x
Han SH , Kim JH , Martin M , Michalek SM , Nahm MH 2003 Pneumococcal lipoteichoic acid (LTA) is not as potent as staphylococcal LTA in stimulating Toll-like receptor 2. Infect. Immun. 71 5541 - 5548    DOI : 10.1128/IAI.71.10.5541-5548.2003
Herías MV , Midtvedt T , Hanson LA , Wold AE 1995 Role ofEscherichia coliP fimbriae in intestinal colonization in gnotobiotic rats. Infect. Immun. 63 4781 - 4789
Isolauri E , Sütas Y , Kankaanpää P , Arvilommi H , Salminen S 2001 Probiotics: effects on immunity. Am. J. Clin. Nutr. 73 (2 Suppl) 444S - 450S
Johansson ML , Molin G , Jeppsson B , Nobaek S , Ahrné S , Bengmark S 1993 Administration of differentLactobacillusstrains in fermented oatmeal soup:in vivocolonization of human intestinal mucosa and effect on the indigenous flora. Appl. Environ. Microbiol. 59 15 - 20
Kaila M , Isolauri E , Soppi E , Virtanen E , Laine S , Arvilommi H 1992 Enhancement of the circulating antibody secreting cell response in human diarrhea by a humanLactobacillusstrain. Pediatr. Res. 32 141 - 144    DOI : 10.1203/00006450-199208000-00002
Kandler O , Weiss N 1986 Regular, non-sporing, gram positive rods. Bergey's Manual Syst. Bacteriol. 2 1208 - 1234
Kim HG , Gim MG , Kim JY , Hwang HJ , Ham MS , Lee JM 2007 Lipoteichoic acid fromLactobacillus plantarumelicits both the production of interleukin-23p19 and suppression of pathogen mediated interleukin-10 in THP-1 cells. FEMS Immunol. Med. Microbiol. 49 205 - 214    DOI : 10.1111/j.1574-695X.2006.00175.x
Kim HG , Kim NR , Gim MG , Lee JM , Lee SY , Ko MY 2008 Lipoteichoic Acid Isolated fromLactobacillus plantarumInhibits Lipopolysaccharide-Induced TNF-alpha Production in THP-1 Cells and Endotoxin Shock in Mice. J. Immunol. 180 2553 - 2561    DOI : 10.4049/jimmunol.180.4.2553
Kim M , Chun J 2005 Bacterial community structure inkimchi, a Korean fermented vegetable food, as revealed by 16S rRNA gene analysis. Int. J. Food Microbiol. 103 91 - 96    DOI : 10.1016/j.ijfoodmicro.2004.11.030
Lee KH , Park JY , Jeong SJ , Kwon GH , Lee HJ , Chang HC 2007 Characterization of paraplantaricin C7, a novel bacteriocin produced byLactobacillus paraplantarumC7 isolated fromkimchi. J. Microbiol. Biotechnol. 17 287 - 296
Madsen K 2006 Probiotics and the immune response. J. Clin. Gastroenterol. 40 232 - 234    DOI : 10.1097/00004836-200603000-00014
Mao Y , Nobaek S , Kasravi B , Adawi D , Stenram U , Molin G , Jeppsson B 1996 The effects ofLactobacillusstrains, and oat fiber on methotrexate-induced enterocolitis in rats. Gastroenterology 111 334 - 344    DOI : 10.1053/gast.1996.v111.pm8690198
Molin G , Jeppsson B , Johansson ML , Ahrné S , Nobaek S , Ståhl M , Bengmark S 1993 Numerical taxonomy ofLactobacillusspp. associated with healthy and diseased mucosa of the human intestines. J. Appl. Bacteriol. 74 314 - 323    DOI : 10.1111/j.1365-2672.1993.tb03031.x
O’Hagan DT , MacKichan ML , Singh M 2001 Recent developments in adjuvants for vaccines against infectious diseases. Biomol. Eng. 18 69 - 85    DOI : 10.1016/S1389-0344(01)00101-0
Ouwehand AC , Salminen S , Isolauri E 2002 Probiotics: an overview of beneficial effects. Antonie Van Leeuwenhoek 82 279 - 289    DOI : 10.1023/A:1020620607611
Perdigón G , Alvarez S , Pesce de Ruiz Holgado A 1991 Immunoadjuvant activity of oralLactobacillus casei: influence of dose on the secretory immune response and protective capacity in intestinal infections. J. Dairy Res. 58 485 - 496    DOI : 10.1017/S0022029900030090
Sacchi CT , Whitney AM , Mayer LW , Morey R , Steigerwalt A , Boras A 2002 Sequencing of 16S rRNA gene: a rapid tool for identification ofBacillus anthracis. Emerg. Infect. Dis. 8 1117 - 1123    DOI : 10.3201/eid0810.020391
Sato Y , Akiyama H , Suganuma H , Watanabe T , Nagaoka MH , Inakuma T 2004 The feeding of beta-carotene down-reg ulates serum Ig E levels and inhibits the type I allergic response in mice. Biol. Pharm. Bull. 27 978 - 984    DOI : 10.1248/bpb.27.978
Telemo E , Karlsson M , Dahlman-Höglund A , Dahlgren U , Lundin S 1997 Oral tolerance in experimental animals. Int. Arch. Allergy Immunol. 113 219 - 223    DOI : 10.1159/000237552
Wadolkowski EA , Laux DC , Cohen PS 1988 Colonization of the streptomycin-treated mouse large intestine by a human fecalEscherichia colistrain: role of adhesion to mucosal receptors. Infect. Immun. 56 1036 - 1043
Wold AE , Thorssén M , Hull S , Edén CS 1988 Attachment ofEscherichia coli viamannose- or Galα1–4Galβ-containing receptors to human colonic epithelial cells. Infect. Immun. 56 2531 - 2537