A Mixed Formulation of Lactic Acid Bacteria Inhibits Trinitrobenzene-Sulfonic-Acid-Induced Inflammatory Changes of the Colon Tissue in Mice
A Mixed Formulation of Lactic Acid Bacteria Inhibits Trinitrobenzene-Sulfonic-Acid-Induced Inflammatory Changes of the Colon Tissue in Mice
Journal of Microbiology and Biotechnology. 2014. Oct, 24(10): 1438-1444
Copyright © 2014, The Korean Society For Microbiology And Biotechnology
  • Received : March 31, 2014
  • Accepted : June 02, 2014
  • Published : October 28, 2014
Export by style
Cited by
About the Authors
Yeon Suk, Cha
School of Biological Sciences, College of Biomedical Sciences and Engineering, Inje University, Gimhae 621-749, Republic of Korea
Jae-Gu, Seo
Research and Development Center, Cell Biotech Co., Ltd., Gimpo 415-871, Republic of Korea
Myung-Jun, Chung
Research and Development Center, Cell Biotech Co., Ltd., Gimpo 415-871, Republic of Korea
Chung Won, Cho
School of Biological Sciences, College of Biomedical Sciences and Engineering, Inje University, Gimhae 621-749, Republic of Korea
Hyun Joo, Youn
School of Biological Sciences, College of Biomedical Sciences and Engineering, Inje University, Gimhae 621-749, Republic of Korea

Lactic acid bacteria (LAB) are probiotics that provide numerous beneficial effects on the host body, especially on the intestine. Combining several strains of LAB, we prepared a formulation containing four different LAB and studied its anti-inflammatory activity both in vitro and in vivo . The formulation significantly reduced NO production from RAW 264.7 cells treated with bacterial lipopolysaccharide, indicating that the formulation might include anti-inflammatory activity. The formulation also suppressed inflammatory change induced by trinitrobenzene sulfonic acid (TNBS) in mice, where oral or rectal administration of the formulation protected the colon tissue from the damage by TNBS. Expressions of the IL-6 and FasL genes appeared to be down-regulated by the formulation in TNBS-treated colon tissues, suggesting that the suppression of those genes may be involved in the anti-inflammatory activity of the formulation.
Lactic acid bacteria (LAB) are the heterogeneous group of acid-tolerant gram-positive bacteria that produce lactic acid as the major fermentation product [16] . Thanks to the production of organic acids, LAB are able to inhibit the growth of harmful bacteria in the fermented food and provide a food item with its own texture and flavor [7] . LAB are also the representative groups of probiotics that provide a wide range of health benefits to the host, such as inhibiting infection, inflammation, and allergy [4 , 6] . Probiotics are well known to control inflammatory processes in the intestine by the modulation of the intestinal microbial environment and the regulation of the gut immune system [20] , which led to the studies of the bacteria for the prevention or treatment of inflammatory conditions including inflammatory bowel disease (IBD) [10 , 12] .
IBD, which includes Crohn’s disease and ulcerative colitis, is the chronic inflammatory condition of the intestine leading to diarrhea, abdominal pain, and even cancer [2] . Recently, the incidence and prevalence of IBD have increased in Asian countries, partly due to changes in the gut microbiota accompanied by the westernization of diet and the increased use of antibiotics [19] . Besides surgical intervention, the treatment of IBD relies on long-term medication with anti-inflammatory and immunosuppressive agents to relieve the symptoms, which brings a great deal of harmful side effects to the patients [3] . If there are any drugs or supplements with long-term safety for IBD patients, especially those from natural resources, they would be used for preventing the diseases as well as treating the symptoms. The findings that potentially harmful bacteria predominated in the intestine of IBD patients suggest that LAB could be applied for the treatment or prevention of IBD [5 , 22 , 23] . Many beneficial effects of probiotics are related to their immunomodulatory capacities as well as anti-inflammatory activities, which also makes LAB the ideal candidates for IBD [10 , 12 , 20] . Certain LAB strains have been shown to stimulate T cell populations responsible for the regulation of inflammatory process, such as regulatory T cells (Treg) [13] . By increasing IL-10 levels, some LAB were successfully used for IBD patients as an adjunct therapy [12] . In our previous study, a mixed LAB formulation composed of four different LAB was shown to inhibit the development of atopic dermatitis in mice [24] , which prompted us to examine the effectiveness of the mixed LAB formulation on other autoimmune-type inflammatory diseases such as IBD. Here, we have studied the anti-inflammatory activity of the mixed LAB formulation in vitro with the lipopolysaccharide (LPS)-induced nitric oxide (NO) production in RAW 264.7 cells, and also in vivo using the trinitrobenzene-sulfonic-acid (TNBS)-induced mouse IBD model.
Materials and Methods
- Mice and Chemicals
6-week-old female ICR mice were purchased from Hyochang Science (Daegu, Korea) and handled in accordance with the protocols approved by the Inje University Animal Resource Center. Mice were housed in polyethylene cages containing clean wood shavings and given rodent chow and tap water ad libitum . Murine macrophage RAW 264.7 cell line was obtained from the Korean Cell Line Bank (Seoul, Korea). Most of the cell culture reagents and chemicals, including TNBS, dexamethasone (Dex), lipopolysaccharide (LPS), Griess reagent, and Dulbecco’s modified Eagle’s medium (DMEM), were purchased from Sigma (St. Louis, MO, USA). Fetal bovine serum (FBS) was from Gibco (Grand Island, NY, USA) and the TACS MTT Assay kit was from R&D systems (Minneapolis, MN, USA). SV Total RNA Isolation System and SYBR Green master mix were obtained from Promega (Madison, WI, USA). Omniscript Reverse Transcriptase for cDNA synthesis was purchased from Qiagen (Hilden, Germany). The primers for polymerase chain reaction (PCR) were synthesized by Bionics Co. (Seoul, Korea). Optimal cutting temperature (OCT) compound for tissue section preparation was purchased from Sakura (Tokyo, Japan) and Harris hematoxylin and eosin for tissue staining were from Youngdong Pharmaceutical (Yongin, Korea) and Sigma Chemical Co., respectively. The four strains of LAB were obtained from Cell Biotech Co., Ltd. (Gimpo, Korea).
- Preparation of the Mixed LAB Formulation
The LAB formulation used in this study, named ATP formulation, was prepared as described previously in the study of the effects of the formulation on an atopic dermatitis model [24] . To make 1 g of ATP formulation, a total of 5 × 10 8 viable cells composed of each 1.25 × 10 8 viable cells of Bifidobacterium lactis (KCTC 11904BP), Lactobacillus casei (KCTC 12398BP), Lactobacillus plantarum (KCTC 10782BP), and Lactobacillus rhamnosus (KCTC 12202BP) were mixed with the filler material containing polydextrose, fructooligosaccharide, glucooligosaccharide, and magnesium stearate, which constituted 85% (w/w) of the formulation.
- In Vitro Anti-Inflammatory Activity of ATP Formulation
RAW 264.7 macrophage cells were plated with DMEM/10% FBS and allowed to adhere to the well. The cells were then treated with ATP formulation at the concentrations of 0.02 (1 × 10 5 colony forming units (CFUs)), 0.1 (5 × 10 5 CFUs), and 0.5 mg/ml (2.5 × 10 6 CFUs), and those treated with 0.01 μM dexamethasone were used as an anti-inflammatory control. After an hour of sample treatment, the cells were then exposed to LPS (0.1 μg/ml) for an additional 15 h. The amounts of NO produced were calculated from the nitrite accumulations in the wells using the Griess reaction [8] . Briefly, 100 μl of each culture supernatant was mixed with an equal volume of Griess reagent at room temperature for 10 min, and the nitrite concentration was calculated using the sodium nitrite standard curve. The amount of live cells in each culture was also determined using the TACS MTT Assay (R&D Systems) as described by the manufacturer. Briefly, culture supernatant of each well was replaced by fresh DMEM and followed by the treatment of the MTT reagent until purple precipitates became evident. Following resolution of the precipitates with the detergent solution, absorbance at 595 nm was measured.
- In Vivo Anti-Inflammatory Activity of ATP Formulation
The anti-inflammatory activity of the ATP formulation was studied in vivo using TNBS-induced IBD model mice [9] .
IBD was induced by the rectal injection of 130 μl of 2% TNBS (dissolved in 50% ethanol) into the descending colon through insertion of a rubber cannula via the anus while the mouse was under anesthesia. The mice were kept in a vertical position for 30 sec and then returned to their cages. Two days after TNBS injection, the mice were sacrificed for the examination of inflammatory changes in the colon tissues. The suppressive effects of the ATP formulation on the inflammatory changes by TNBS have been studied with two independent protocols, using the rectal or the oral administration of the fraction. For the study of the rectal administration of ATP formulation on TNBS-induced colitis, solutions containing the ATP formulation mixed in 2% TNBS were injected into the colon and the degrees of inflammatory changes of the treated tissues were examined. In this protocol, mice were divided into five groups: a control group injected with vehicle (filler) and 50% ethanol; a TNBS-treated control group injected with vehicle and 2% TNBS; and three ATP formulation-treated groups injected with 1 mg (5 × 10 6 CFUs) , 2 mg (1 × 10 7 CFUs), or 4 mg (2 × 10 7 CFUs) of ATP formulation mixed in 2% TNBS, respectively. The effects of oral administration of the ATP formulation on the TNBS-induced bowel inflammation were examined using the mice pre-treated with the oral feeding of ATP formulation prior to the rectal injection of TNBS. Briefly, mice were fed with 4 mg (2 × 10 7 CFUs) of ATP formulation three times a day for two consecutive days, which were then followed by the rectal injections of 2% TNBS at 2 h after the final feeding of ATP formulation. In this experiment, mice were divided into three groups: a control group with oral administration of vehicle and rectal injection of 50% ethanol; a TNBS-treated control group with oral administration of vehicle and rectal injection of 2% TNBS; and a ATP formulation-treated group with oral administration of 4 mg of ATP formulation and rectal injection of 2% TNBS. All groups in both the rectal and the oral protocols included at least three mice.
Degrees of inflammatory changes of the colon tissues were examined by comparing the thickness of the colon wall, necrotic damage of the colon surface, and histologic analysis of the colon tissue sections. Colon segments from the region 4 cm proximal to the anus were excised and subjected to the measurement of colon wall thickness and the observation of hemorrhagic necrosis on the colon wall surface. The excised colon tissue segments were then preserved in 10% formaldehyde, and the fixed tissues were embedded in OCT compound prior to being sectioned with a cryostat. The 5 μm sections were then stained with hematoxylin and eosin (HE staining) and examined under a light microscope for any disruption of the epithelial mucosa structure and the infiltration of inflammatory cells into the colon tissues.
- Effects of ATP Formulation on the Gene Expression in the Colon Tissue
Modulation of the gene expression in the colon tissues treated with TNBS by the ATP formulation was examined using the reverse-transcriptase polymerase chain reaction (RT-PCR). RNAs were prepared from the colon tissue sections of the mice fed with 4 mg of ATP formulation three times a day for two consecutive days and then treated with the rectal injections of 2% TNBS. The RNAs from the tissues of the mice fed with the filler material and treated with 2% TNBS were used as the vehicle-treated control. Total RNAs were prepared using the SV Total RNA Isolation System as described by the manufacturer and then subjected to complementary DNA (cDNA) synthesis with an Omniscript RT kit (Qiagen, Germany). The cDNAs were then amplified using a number of primer sets for the mouse genes known to be involved in the inflammatory process, including the IL-6, FasL, and Fas genes. The primer set TGCACTTGCAGAAAACAATC and TGGTCTTGGTCCTTAGCC was used for IL-6. The primer set CAACACAAATCTGTGGCTACCG and CCCATATCTGTCCAGTAGTGCA was synthesized for FasL, and the set AGGAATTCGTGTGAACATGGAACCCT and AGAAGCTTCACTCCAGACATTGTCCT was for Fas. The primer set GGCACCAGGGTGTGATGG and ACGGTTGGCCTTAGGGTTC was selected for β-actin. PCRs were carried out using the following conditions: one cycle of 94℃ for 5 min; 30 cycles of denaturation at 94℃ for 4 sec, annealing at 60℃ for 4 sec, and elongation at 72℃ for 45 sec; and an extension cycle at 72℃ for 10 min.
- Statistical Analysis
Data were evaluated using Student’s t -test, and p < 0.05 was considered as statistically significant.
- Effect of ATP Formulation on NO Release from the LPS-Treated RAW 264.7 Cells
NO production from RAW 264.7 cells treated with LPS is a useful model system for the study of inflammation in vitro , where the ATP formulation significantly suppressed NO production in a dose-dependent manner ( Fig. 1 A). Compared with the NO amount from the cells treated with LPS alone, the cells treated with 2 or 4 mg/ml of ATP formulation showed an almost 2-fold decrease in NO production ( Fig. 1 A-e and 1 A-f), which suggests that the formulation may include anti-inflammatory activity. In order to see if the ATP formulation could influence the amount of NO production in the cultures through the modulation of cell growth, the viabilities of the RAW 264.7 cells in the cultures were examined with the MTT reduction assay. As shown in Fig. 1 B, there were no significant differences in the viable cell density between the culture conditions ( Fig. 1 B), indicating that the concentrations of ATP formulation used in the study just modulated the NO production process without affecting the number of cells in the cultures. This result shows that the ATP formulation exhibits anti-inflammatory activity in vitro , and suggests that the formulation may play a role in the development of inflammatory diseases in vivo .
PPT Slide
Lager Image
NO production from RAW 264.7 cells treated with ATP formulation (A) and viabilities of the cells in the cultures (B). Lane a) represents the cells treated only with vehicle (filler) without LPS treatment. Lanes b) and c) are those treated with vehicle and dexamethasone (Dex) prior to LPS addition, respectively. Lanes d), e), and f) represent cells treated with the ATP formulation at the concentrations of 1, 2, and 4 mg/ml, respectively, before LPS treatment. The P values less than 0.05 compared with the LPS-treated control (lane b) are indicated with asterisks.
- Suppression of the TNBS-Induced Bowel Inflammation by the Rectal Injection of ATP Formulation
Whereas the mice treated with TNBS alone showed IBD-like changes such as inflammation and hemorrhage of the colon tissue around the TNBS-treated area, those receiving the rectal injection of the mixture of TNBS and ATP formulation did not show any of those inflammatory changes ( Fig. 2 ) . The colon walls from the mice treated with TNBS alone showed significant thickening ( Fig. 2 A-b), whereas those from the mice co-injected with TNBS and 2 or 4 mg ATP formulation did not present any significant colon wall thickening ( Fig. 2 A-d and 2 A-e), indicating that the ATP formulation protected the colon tissue from the TNBS-induced edematous change. Examination of the colon wall surface revealed that the co-injection of TNBS and ATP formulation blocked necrotic damage induced by TNBS ( Fig. 2 B). Whereas the colon wall surfaces of the mice treated with TNBS alone appeared to be very dark, probably due to the hemorrhagic necrosis of the colon tissues ( Fig. 2 B-b), those of the mice co-injected with TNBS and 2 or 4 mg ATP formulation ( Fig. 2 B-d and 2 B-e) turned out to be as clean as the walls of the TNBS-untreated control mice ( Fig. 2 B-a). All these observations indicate that the ATP formulation prevented the development of inflammatory changes induced by TNBS in a dose-dependent manner.
PPT Slide
Lager Image
Effects of the rectal injection of ATP formulation on the TNBS-induced colitis development. Panels (A) and (B) represent the thickness of the colon wall and macroscopic appearance of the colon wall surfaces, respectively. Lane a) represents a control group injected with vehicle (filler) and 50% ethanol, and lane b) indicates another control group injected with vehicle and TNBS. Lanes c), d), and e) indicate the ATP-formulation-treated groups injected with TNBS mixed with 1, 2, or 4 mg of ATP formulation, respectively. The numbers in (B) represent the same numbers described in (A). The P values less than 0.05 compared with the TNBS-treated control (lane b) are indicated with asterisks.
- Suppression of the TNBS-Induced Bowel Inflammation by the Oral Administration of ATP Formulation
The effects of the oral feeding of ATP formulation on the TNBS-induced colitis were also examined in order to see whether ATP formulation modulated the bowel tissue of the mice to suppress the inflammatory changes by TNBS. In this protocol, mice were pre-treated with the oral feeding of 4 mg of ATP formulation three times a day for two consecutive days and then treated with rectal injection of TNBS. When examined for wall thickness, surface necrosis, epithelial mucosa integrity, and inflammatory cell infiltration, the mice pre-treated with the oral feedings of ATP formulation showed significant inhibition of the inflammatory changes induced by TNBS ( Fig. 3 ). Compared with the TNBS-treated control mice ( Fig. 3 A-b), mice fed with the ATP formulation showed significant reduction in the colon wall thickness ( Fig. 3 A-c), almost to the level of the TNBS-untreated controls ( Fig. 3 A-a). Examination of the colon wall surfaces also did not show any significant necrotic damage by TNBS in the mice pre-treated with the formulation ( Fig. 3 B). Whereas the mice treated with rectal injection of TNBS alone developed strong dark areas on the wall surfaces due to the hemorrhagic necrosis of the colon tissues ( Fig 3 B-b), those fed with the ATP formulation prior to TNBS treatment did not show any damage on the wall surfaces ( Fig. 3 B-c) as in those of the TNBS-untreated controls ( Fig. 3 B-a). The oral feeding of ATP formulation also suppressed both the ulcerative damage of the colon epithelial mucosa and the leukocyte infiltration into the colon tissue induced by the rectal injection of TNBS ( Fig. 3 C). The colon epithelial mucosa of the mice treated with TNBS presented complete destruction of epithelial structure ( Fig. 3 C-b), whereas those of mice fed with the ATP formulation did not show any damage by TNBS ( Fig 3 C-c). These findings indicate that the oral feeding of ATP formulation could modulate the colon tissue to block the TNBS-induced inflammatory development and tissue damage.
PPT Slide
Lager Image
Effects of the oral feeding of ATP formulation on the TNBS-induced colitis development. Panels (A), (B), and (C) represent the colon wall thickness, the macroscopic appearance of the colon wall surface, and the HE staining of the colon tissue section, respectively. Lane a) represents a control group treated with the oral feeding of vehicle (filler) prior to the rectal injection of ethanol. Lane b) represents another control group treated with the oral feeding of vehicle before the rectal injection of TNBS. Lanes c) represents the ATP-formulation-treated groups treated with the oral feeding of 4 mg of ATP formulation before the rectal injection of TNBS. The numbers in (B) and (C) represent the same numbers described in (A). The P value less than 0.05 compared with the TNBS-treated control (lane b) is indicated with an asterisk.
- ATP Formulation May Suppress the TNBS-Induced Bowel Inflammation Through the Down-Regulation of IL-6 and FasL Expression
We have examined the effect of the ATP formulation on the transcription levels of pro-inflammatory or immuno-modulatory genes in the colon tissue in order to have an idea on the anti-inflammatory activity of the formulation. After mice were treated with oral feeding of the ATP formulation or vehicle and following rectal injection of TNBS, RNAs were prepared from the colon tissue sections near the TNBS injection sites and gene expression changes were examined ( Fig. 4 ). The reverse-transcriptase PCR study showed that the colon tissues from the mice treated with ATP formulation and TNBS showed strong down-regulation of IL-6 and F asL gene expression ( Fig. 4 A-b), compared with the expression levels of the genes in the mice treated with TNBS alone ( Fig. 4 A-a).
PPT Slide
Lager Image
Reverse-transcriptase PCR analysis of the gene expression in the colon tissues from mice treated with the oral feeding of ATP formulation or vehicle and rectal injection of TNBS. Lane a) indicates the RNAs prepared from the mice treated with TNBS alone, and lane b) represents those from the mice treated with ATP formulation and TNBS.
NO produced by macrophages plays a role in the inflammatory response, and thus NO production from LPS-treated RAW 264.7 macrophage cells is a good model system for the study of inflammation in vitro [21] . Using this in vitro system, we were able to identify that the ATP formulation containing four probiotic LAB strains significantly suppressed NO production in a dose-dependent manner, indicating that the formulation presents anti-inflammatory activity. Considering that IBD includes complex autoimmune diseases involving increased luminal activities of nitric oxide and inflammatory processes [2] , we decided to study if the formulation could block inflammatory development in mice treated with TNBS, a mouse model of a human IBD. In both studies, using the rectal injection and the oral feeding of ATP formulations, the formulation prevented the colon wall thickening as well as hemorrhagic necrosis induced by TNBS. Histologic studies of the colon tissues also showed that the formulation blocked ulcerative damage of the colon epithelial mucosa and leukocyte infiltration into the colon tissue. Since the known characteristics of IBD involve NO production, colon wall thickening, hemorrhagic necrosis, leucocytes infiltration, and epithelial mucosa disruption [2 , 11] , all these findings clearly indicate that the ATP formulation effectively inhibited the inflammatory process and damage induced by TNBS. The findings from the oral-feeding protocol, where the feeding of ATP formulation blocked the inflammatory changes by the rectal injection of TNBS, suggest that the feeding of ATP formulation provided enough probiotics into the colon tissue and modulated the micro-environment of the tissue to resist inflammatory changes induced by the rectal injection of TNBS.
Considering that cytokines and other immune-modulators are involved in the regulation of inflammatory response in IBD [28 , 30] , we have examined the genes whose expressions were modulated by the ATP formulation, in order to imagine how the formulation showed the anti-IBD activity. Among the genes up-regulated by TNBS, the expressions of IL-6 and FasL appeared to be suppressed by the feeding of ATP formulation, while the expression of Fas remained unchanged. Since the expression levels of IL-6 and FasL were increased in human IBD [1 , 32] , the down-regulations of those genes by the ATP formulation in TNBS-treated tissues could explain the protective anti-inflammatory activity of the formulation. It is also interesting that FasL is involved in the production of IL-6 [31] . IL-6 is a pro-inflammatory cytokine and plays an important role in the inflammatory development of IBD [17] , which indicates that the ATP formulation blocks inflammatory changes by TNBS through modulation of the IL-6-induced inflammatory process. In addition to the pro-inflammatory activity of IL-6, IL-6 could also contribute to the survival of tissue-damaging effector T cells and the perpetuation of chronic intestinal inflammation [1] , which also supports the protective effect of the down-regulation of IL-6 by the ATP formulation. In addition to the role of FasL on the IL-6 expression [31] , FasL could be directly involved in the TNBS-induced tissue damage. Since FasL is a death receptor signaling effector-T-cell-mediated cell death [27 , 29] , the down-regulation of FasL by the ATP formulation could be responsible for the reduction of the interaction of FasL on the colon tissue cells with Fas on the infiltrating lymphocytes [15] . In addition to the direct role of FasL on cell death, the decreased FasL expression by the ATP formulation could not provide a co-stimulatory signal for the Fas-expressing effector T cell development and might not lead to effector T cell activation [14 , 18 , 25] .
In this study, a formulation containing mixed LAB strains was found to have some protective effect on the development of inflammatory changes in an IBD model, which could be exploited to develop probiotic formulations for the treatment or prevention of IBD. Since the long-term consumption of IBD medications itself becomes a great threat to patients [26] , protective formulations like the ATP formulation also can be used as an adjunct therapy for IBD patients to reduce the amount of the medications or potentiate the effect of the conventional treatments.
This work was supported by a 2011 Inje University research grant. The authors wish to express their thanks to Dr. Jung Suk Hwang of Changwon Samsung Hospital for her help in the histologic analysis of the mouse colon tissues.
Atreya R , Mudter J , Finotto S , Mullberg J , Jostock T , Wirtz S 2000 Blockade of interleukin 6 trans signaling suppresses T-cell resistance against apoptosis in chronic intestinal inflammation: evidence in Crohn disease and experimental colitis in vivo. Nat. Med. 6 583 - 588    DOI : 10.1038/75068
Baumgart DC , Carding SR 2007 Inflammatory bowel disease: cause and immunobiology. Lancet 369 1627 - 1640    DOI : 10.1016/S0140-6736(07)60750-8
Baumgart DC , Sandborn WJ 2007 Inflammatory bowel disease: clinical aspects and established and evolving therapies. Lancet 369 1641 - 1657    DOI : 10.1016/S0140-6736(07)60751-X
Behnsen J , Deriu E , Sassone-Corsi M , Raffatellu M 2013 Probiotics: properties, examples, and specific applications. Cold Spring Harb. Perspect. Med. 3 1 - 15    DOI : 10.1101/cshperspect.a010074
Conte MP , Schippa S , Zamboni I , Penta M , Chiarini F , Seganti L 2006 Gut-associated bacterial microbiota in paediatric patients with inflammatory bowel disease. Gut. 55 1760 - 1767    DOI : 10.1136/gut.2005.078824
Delcenserie V , Martel D , Lamoureux M , Amiot J , Boutin Y , Roy D 2008 Immunomodulatory effects of probiotics in the intestinal tract. Curr. Issues Mol. Biol. 10 37 - 54
Fuller R 1989 Probiotics in man and animals. J. Appl. Bacteriol. 66 365 - 378    DOI : 10.1111/j.1365-2672.1989.tb05105.x
Green LC , Wagner DA , Glogowski J , Skipper PL , Wishnok JS , Tannenbaum SR 1982 Analysis of nitrate, nitrite, and [15N]nitrate in biological fluids. Anal. Biochem. 126 131 - 138    DOI : 10.1016/0003-2697(82)90118-X
Hong T , Jin G , Yoshino G , Miura M , Maeda Y , Cho S , Cyong J 2002 Protective effects of Polygalae root in experimental TNBS-induced colitis in mice. J. Ethnopharmacol. 79 341 - 346    DOI : 10.1016/S0378-8741(01)00399-3
Kekkonen RA , Lummela N , Karjalainen H , Latvala S , Tynkkynen S , Jarvenpaa S 2008 Probiotic intervention has strain-specific anti-inflammatory effects in healthy adults. World J. Gastroenterol. 14 2029 - 2036    DOI : 10.3748/wjg.14.2029
Larsson A , Melgar S , Rehnström E , Michaëlsson E , Svensson L , Hockings P 2006 MRI of colon wall thickness - a biomarker in experimental mouse inflammatory disease? Inflamm. Bowel Dis. 12 478 - 485    DOI : 10.1097/00054725-200606000-00006
LeBlanc JG , de Moreno de Leblanc A , Perdigón G , Miyoshi A , Rochat T , Bermudez-Humaran L 2008 Antiinflammatory properties of lactic acid bacteria: current knowledge, applications and prospects. Antiinfect. Agents Med. Chem. 7 148 - 154    DOI : 10.2174/187152108784911287
Leon F , Smythies LE , Smith PD , Kelsall BL 2006 Involvement of dendritic cells in the pathogenesis of inflammatory bowel disease. Adv. Exp. Med. Biol. 579 117 - 132
Lettau M , Paulsen M , Schmidt H , Janssen O 2011 Insights into the molecular regulation of FasL (CD178) biology. Eur. J. Cell Biol. 90 456 - 466    DOI : 10.1016/j.ejcb.2010.10.006
Lin WW , Hsieh SL 2011 Decoy receptor 3: a pleiotropic immunomodulator and biomarker for inflammatory diseases, autoimmune diseases and cancer. Biochem. Pharmacol. 81 838 - 847    DOI : 10.1016/j.bcp.2011.01.011
Masood MI , Qadir MI , Shirazi JH , Khan IU 2011 Beneficial effects of lactic acid bacteria on human beings. Crit. Rev. Microbiol. 37 91 - 98    DOI : 10.3109/1040841X.2010.536522
Mudter J , Amoussina L , Schenk M , Yu J , Brüstle A , Weigmann B 2008 The transcription factor IFN regulatory factor-4 controls experimental colitis in mice via T cell-derived IL-6. J. Clin. Invest. 118 2415 - 2426
Nakano K , Saito K , Mine S , Matsushita S , Tanaka Y 2007 FasL expressed on activated T cell, interact with Fas homeostasis. Apoptosis 12 45 - 54    DOI : 10.1007/s10495-006-0488-8
Prideaux L , Kamm MA , de Cruz PP , Chan FKL , Ng SC 2012 Inflammatory bowel disease in Asia: a systematic review. J. Gastroenterol. Hepatol. 27 1266 - 1280    DOI : 10.1111/j.1440-1746.2012.07150.x
Purchiaroni F , Tortora A , Gabrielli M , Bertucci F , Gigante G , Ianiro G 2013 The role of intestinal microbiota and the immune system. Eur. Rev. Med. Pharmacol. Sci. 17 323 - 333
Sacco R , Waters W , Rudolph K , Drew M 2006 Comparative nitric oxide production by LPS-stimulated monocyte-derived macrophages from Ovis canadensis and Ovis aries. Comp. Immunol. Microbiol. Infect. Dis. 29 1 - 11    DOI : 10.1016/j.cimid.2005.11.001
Schultsz C , Van Den Berg FM , Ten Kate FW , Tytgat GN , Dankert J 1999 The intestinal mucus layer from patients with inflammatory bowel disease harbors high numbers of bacteria compared with controls. Gastroenterology 117 1089 - 1097    DOI : 10.1016/S0016-5085(99)70393-8
Seksik P , Rigottier-Gois L , Gramet G , Sutren M , Pochart P , Marteau P 2003 Alterations of the dominant faecal bacterial groups in patients with Crohn’s disease of the colon. Gut 52 237 - 242    DOI : 10.1136/gut.52.2.237
Seo JG , Chung MJ , Lee HG 2011 Alleviation of atopic dermatitis through probiotic and mixed-probiotic treatments in an atopic dermatitis model. Korean J. Food Sci. Anim. Resour. 31 420 - 427    DOI : 10.5851/kosfa.2011.31.3.420
Souza HS , Tortori CJ , Castelo-Branco MT , Carvalho AT , Margallo VS , Delgado CF 2005 Apoptosis in the intestinal mucosa of patients with inflammatory bowel disease: evidence of altered expression of FasL and perforin cytotoxic pathways. Int. J. Colorectal Dis. 20 277 - 286    DOI : 10.1007/s00384-004-0639-8
Triantafillidis J , Merikas E , Georgopoulos F 2011 Current and emerging drugs for the treatment of inflammatory bowel disease. Drug Des. Devel. Ther. 5 185 - 210    DOI : 10.2147/DDDT.S11290
Villa-Morales M , Fernández-Piqueras J 2012 Targeting the Fas/FasL signaling pathway in cancer therapy. Expert Opin. Ther. Targets 16 85 - 101    DOI : 10.1517/14728222.2011.628937
Wang K , Yuan CP , Wang W , Yang ZQ , Cui W , Mu LZ 2010 Expression of interleukin 6 in brain and colon of rats with TNBS-induced colitis. World J. Gastroenterol. 16 2252 - 2259    DOI : 10.3748/wjg.v16.i18.2252
Weigelin B , Krause M , Friedl P 2011 Cytotoxic T lymphocyte migration and effector function in the tumor microenvironment. Immunol. Lett. 138 19 - 21    DOI : 10.1016/j.imlet.2011.02.016
Xavier R , Podolsky D 2007 Unraveling the pathogenesis of inflammatory bowel disease. Nature 448 427 - 434    DOI : 10.1038/nature06005
Yamamoto J , Maeno K , Takada T , Kakutani K , Yurube T , Zhang Z 2013 Fas ligand plays an important role for the production of pro-inflammatory cytokines in intervertebral disc nucleus pulposus cells. J. Orthop. Res. 31 608 - 615    DOI : 10.1002/jor.22274
Yukawa M , Iizuka M , Horie Y , Yoneyama K , Shirasaka T , Itou H 2002 Systemic and local evidence of increased Fas-mediated apoptosis in ulcerative colitis. Int. J. Colorectal Dis. 17 70 - 76    DOI : 10.1007/s003840100340